Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4894
Trapped Gene
Mysm1 (ENSMUSG00000062627)
Vector Insertion
Chr 4: 94639680 - 94641907
Public Clones AR1219 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 6% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000349848 (Chr4:94641908..94641983 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCAACGTGGAGAAGGGAAAA Chr4:94641918..94641937 60.6 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000349848 (Chr4:94641908..94641983 -)
Downstram Exon
ENSMUSE00000358844 (Chr4:94639609..94639679 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCAACGTGGAGAAGGGAAAA Chr4:94641918..94641937 60.6 45 TGGTGCTATCCAGAGTCCAA Chr4:94639636..94639655 59.24 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000390662 Chr4:94645695..94645791 TGTGGATGTGGAAGGAGATGT Chr4:94645716..94645736 60.38 47.62
upstream ENSMUSE00000349848 Chr4:94641908..94641983 TCAACGTGGAGAAGGGAAAA Chr4:94641918..94641937 60.6 45

*** Putative Vector Insertion (Chr 4: 94639680 - 94641907) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000358844 Chr4:94639609..94639679 TGGTGCTATCCAGAGTCCAA Chr4:94639636..94639655 59.24 50
downstream ENSMUSE00000402969 Chr4:94637315..94637392 CCCAGAATTTTCCTGGAAGT Chr4:94637330..94637349 58.09 45
downstream ENSMUSE00000497581 Chr4:94637203..94637226 TGGCTTTTGATGACTTCTGC Chr4:94637182..94637201 59 45
downstream ENSMUSE00000394760 Chr4:94635671..94635749 GCTGGTTTTGCAGGAGAATC Chr4:94635704..94635723 59.82 50
downstream ENSMUSE00000298939 Chr4:94634561..94634659 No primer for this exon
downstream ENSMUSE00000525934 Chr4:94631820..94632562 TCCACTTGAGTCCTGCCTCT Chr4:94632001..94632020 59.99 55
downstream ENSMUSE00000525933 Chr4:94628394..94628524 GTTCTTCAGGCCAGGACGTA Chr4:94628445..94628464 60.26 55
downstream ENSMUSE00000525932 Chr4:94627019..94627122 CAAGTGGTTGTGGCCTGTTA Chr4:94627068..94627087 59.61 50
downstream ENSMUSE00000525931 Chr4:94625604..94625681 TTTGCATCACACCAGTTTCC Chr4:94625607..94625626 59.55 45
downstream ENSMUSE00000525930 Chr4:94623741..94623829 TTGCCATCTCCTCCACAGAC Chr4:94623783..94623802 61.23 55
downstream ENSMUSE00000525929 Chr4:94620563..94620617 No primer for this exon
downstream ENSMUSE00000525928 Chr4:94620189..94620239 No primer for this exon
downstream ENSMUSE00000471179 Chr4:94619554..94619628 TCACCTCTGCCATAGACACG Chr4:94619579..94619598 59.85 55
downstream ENSMUSE00000506734 Chr4:94618865..94619053 TTCTGAGGCCTGTGTCTGTG Chr4:94618948..94618967 60.02 55
downstream ENSMUSE00000520119 Chr4:94617617..94617749 CCAAGCAGGTTATCTGGGAAT Chr4:94617631..94617651 60.33 47.62
downstream ENSMUSE00000508790 Chr4:94615020..94615125 TTCCCACTGAGGTTCTTCTAACA Chr4:94615051..94615073 60.15 43.48
downstream ENSMUSE00000509687 Chr4:94614793..94614850 CGGCGAAAGATTCTATCCAT Chr4:94614799..94614818 59.14 45
downstream ENSMUSE00000510826 Chr4:94608732..94613814 GACAGCTTAGGCTGGAATGC Chr4:94610326..94610345 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCAGCTAGTTGCCCAGAGTT Chr4:94641855..94641875 59.64 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCAGCTAGTTGCCCAGAGTC Chr4:94641855..94641875 60.16 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000062627