Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4895
Trapped Gene
Dynlrb1 (ENSMUSG00000047459)
Vector Insertion
Chr 2: 155062673 - 155068466
Public Clones AR0435 (sanger) (ggtc) 5SE306H07 (ggtc) 3SE306H07 (ggtc)
Private Clones OST67846 (lexicon) OST34783 (lexicon) OST23016 (lexicon)
Severity of mutation (?) Insertion after 1% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000681199 (Chr2:155062646..155062672 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000681199 (Chr2:155062646..155062672 +)
Downstram Exon
ENSMUSE00000457125 (Chr2:155068467..155068542 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CTGCACTCCTTTCTGGCTCT Chr2:155068520..155068539 59.74 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000681203 Chr2:155062293..155062353 No primer for this exon
upstream ENSMUSE00000681199 Chr2:155062646..155062672 No primer for this exon

*** Putative Vector Insertion (Chr 2: 155062673 - 155068466) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000457125 Chr2:155068467..155068542 CTGCACTCCTTTCTGGCTCT Chr2:155068520..155068539 59.74 55
downstream ENSMUSE00000373807 Chr2:155073507..155073674 TGTAGTGGTGGGATTGTCCA Chr2:155073550..155073569 59.81 50
downstream ENSMUSE00000639720 Chr2:155075657..155076008 GACTGGATCAGAGGCACTCC Chr2:155075867..155075886 59.8 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGGAAGTAGGTACGGCCATT Chr2:155062669..155062689 60.21 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCATTAGGGCCATCTTCACA Chr2:155062684..155062704 60.85 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000047459