Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4900
Trapped Gene
Tmem161b (ENSMUSG00000035762)
Vector Insertion
Chr 13: 84361930 - 84362040
Public Clones AT0180 (sanger) AK0102 (sanger) D028G05 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000708985 (Chr13:84361931..84362039 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTTTCGAGAGCTCCGTTTTG Chr13:84361943..84361962 59.99 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000708985 (Chr13:84361931..84362039 +)
Downstram Exon
ENSMUSE00000713302 (Chr13:84361931..84362039 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTTTCGAGAGCTCCGTTTTG Chr13:84361943..84361962 59.99 50 CAAAACGGAGCTCTCGAAAC Chr13:84361965..84361984 59.99 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC

*** Putative Vector Insertion (Chr 13: 84361930 - 84362040) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000708985 Chr13:84361931..84362039 CAAAACGGAGCTCTCGAAAC Chr13:84361965..84361984 59.99 50
downstream ENSMUSE00000713302 Chr13:84361931..84362039 CAAAACGGAGCTCTCGAAAC Chr13:84361965..84361984 59.99 50
downstream ENSMUSE00000400401 Chr13:84390835..84390938 CAGAGTAGCCATCGAGCAAG Chr13:84390932..84390951 58.78 55
downstream ENSMUSE00000403723 Chr13:84397366..84397449 TCTTCTTCGGAAGGATGTTGA Chr13:84397400..84397420 59.8 42.86
downstream ENSMUSE00000363602 Chr13:84399748..84399845 AGGTCAATGTCTTTTGGAATGG Chr13:84399805..84399826 60.22 40.91
downstream ENSMUSE00000470322 Chr13:84411776..84411954 CCACCAGCCACTGGTATTCT Chr13:84411814..84411833 59.99 55
downstream ENSMUSE00000519398 Chr13:84411776..84411932 CCACCAGCCACTGGTATTCT Chr13:84411814..84411833 59.99 55
downstream ENSMUSE00000248330 Chr13:84422316..84422467 TGCCATTGCTTTAACGAAGA Chr13:84422424..84422443 59.44 40
downstream ENSMUSE00000248327 Chr13:84422909..84422969 TGCATTGCACTGTCTGAAAA Chr13:84422942..84422961 58.99 40
downstream ENSMUSE00000248321 Chr13:84423590..84423730 AAGCCCCAATGAGTGAACAG Chr13:84423657..84423676 60.11 50
downstream ENSMUSE00000248317 Chr13:84426290..84426403 ATTGGTTTCACCCAGAGCAG Chr13:84426355..84426374 60.11 50
downstream ENSMUSE00000248311 Chr13:84431984..84432158 TATGCTTGCAGGTGACTTCG Chr13:84432082..84432101 60.01 50
downstream ENSMUSE00000518452 Chr13:84432986..84433082 CATACTGCAGGGCAATGACA Chr13:84433034..84433053 60.69 50
downstream ENSMUSE00000640906 Chr13:84434208..84435569 AAGGCGGCTTCTGGATAAAT Chr13:84434247..84434266 60.06 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCAGAACCTGAAGGGGAGTA Chr13:84361963..84361983 59.28 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGTTTCGAGAGCTCCGTTTT Chr13:84361943..84361963 60.74 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000035762