Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4914
Trapped Gene
Srbd1 (ENSMUSG00000024135)
Vector Insertion
Chr 17: 86514637 - 86519253
Public Clones AR0079 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 10% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000605991 (Chr17:86519254..86519389 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGCAACATAAGGACCATCCA Chr17:86519264..86519283 59.92 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000605991 (Chr17:86519254..86519389 -)
Downstram Exon
ENSMUSE00000605990 (Chr17:86514533..86514636 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGCAACATAAGGACCATCCA Chr17:86519264..86519283 59.92 45 TGTTGACTTTGACGGTCAGG Chr17:86514560..86514579 59.72 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000691064 Chr17:86544461..86544515 TCTTCTCCAGATTCGCCAAG Chr17:86544468..86544487 60.47 50
upstream ENSMUSE00000138626 Chr17:86541700..86541779 CATTGCGCAAAAGAGTGAAA Chr17:86541753..86541772 59.99 40
upstream ENSMUSE00000691063 Chr17:86541700..86541779 CATTGCGCAAAAGAGTGAAA Chr17:86541753..86541772 59.99 40
upstream ENSMUSE00000138628 Chr17:86538409..86538589 CGAAGAAGAGCTCCCAACAG Chr17:86538451..86538470 60.13 55
upstream ENSMUSE00000138631 Chr17:86535786..86535875 CCACAAGTTGCAGACGACAA Chr17:86535812..86535831 60.91 50
upstream ENSMUSE00000605996 Chr17:86535504..86535875 GAGAGCGAGGACAGCTTCAC Chr17:86535628..86535647 60.29 60
upstream ENSMUSE00000605995 Chr17:86529454..86529620 GCCAACATCATACGCCTCTT Chr17:86529562..86529581 60.1 50
upstream ENSMUSE00000605994 Chr17:86527056..86527173 AAAATGTCGGAGTGCTTGCT Chr17:86527102..86527121 59.88 45
upstream ENSMUSE00000605993 Chr17:86525451..86525589 CTAGAAGGAGCAGCGTGGAC Chr17:86525510..86525529 60.16 60
upstream ENSMUSE00000605992 Chr17:86519990..86520086 GCCTTTCTGAGCTCAACGAT Chr17:86520067..86520086 59.58 50
upstream ENSMUSE00000691065 Chr17:86519990..86520062 No primer for this exon
upstream ENSMUSE00000605991 Chr17:86519254..86519389 TGCAACATAAGGACCATCCA Chr17:86519264..86519283 59.92 45

*** Putative Vector Insertion (Chr 17: 86514637 - 86519253) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000605990 Chr17:86514533..86514636 TGTTGACTTTGACGGTCAGG Chr17:86514560..86514579 59.72 50
downstream ENSMUSE00000605989 Chr17:86508567..86508674 ACAATGAGGCGCTTAAAGGA Chr17:86508569..86508588 59.85 45
downstream ENSMUSE00000605988 Chr17:86502183..86502340 GCCAGGATCTACTCCCATCA Chr17:86502201..86502220 60.03 55
downstream ENSMUSE00000605987 Chr17:86498545..86498635 CATCCGTGTGAAGGATCTGA Chr17:86498593..86498612 59.63 50
downstream ENSMUSE00000605986 Chr17:86497852..86497959 CAGTTCCATTTCCGATCACC Chr17:86497906..86497925 60.32 50
downstream ENSMUSE00000605985 Chr17:86457016..86457107 TCGGGGCTGACACTGTAGAT Chr17:86457041..86457060 60.68 55
downstream ENSMUSE00000605984 Chr17:86450426..86450508 GATCTTGAACACGCCTTGCT Chr17:86450460..86450479 60.41 50
downstream ENSMUSE00000656923 Chr17:86450407..86450508 GATCTTGAACACGCCTTGCT Chr17:86450460..86450479 60.41 50
downstream ENSMUSE00000656922 Chr17:86444217..86444296 TCCTGTAAACCCCTCCCTCT Chr17:86444242..86444261 59.93 55
downstream ENSMUSE00000605983 Chr17:86403187..86403293 ATCCACTCCCACAAAGCTGA Chr17:86403194..86403213 60.66 50
downstream ENSMUSE00000361942 Chr17:86400771..86400947 TGCAGAATGTCCGGATGTAA Chr17:86400750..86400769 60.07 45
downstream ENSMUSE00000539262 Chr17:86399661..86399816 AGTCTGGTCCAGTGGGTTTG Chr17:86399674..86399693 60 55
downstream ENSMUSE00000605980 Chr17:86399661..86399813 AGTCTGGTCCAGTGGGTTTG Chr17:86399674..86399693 60 55
downstream ENSMUSE00000375453 Chr17:86387665..86387849 TCTTTCCCGAGAGACACGTT Chr17:86387744..86387763 59.84 50
downstream ENSMUSE00000605979 Chr17:86384006..86384823 TGAACCGGATAGGAATCAGC Chr17:86384649..86384668 60.04 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr17:86516182..86516202 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000024135