Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4919
Trapped Gene
5830415L20Rik (ENSMUSG00000058503)
Vector Insertion
Chr 5: 3543948 - 3554315
Public Clones AP0177 (sanger) RHA271 (baygenomics) IST11272E7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000656308 (Chr5:3543833..3543947 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000656308 (Chr5:3543833..3543947 +)
Downstram Exon
ENSMUSE00000703270 (Chr5:3554316..3554335 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000656308 Chr5:3543833..3543947 No primer for this exon

*** Putative Vector Insertion (Chr 5: 3543948 - 3554315) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000703270 Chr5:3554316..3554335 No primer for this exon
downstream ENSMUSE00000703269 Chr5:3554638..3554736 GGCCTTGGTCGATTCAGATA Chr5:3554733..3554752 60.04 50
downstream ENSMUSE00000184905 Chr5:3554639..3554736 GGCCTTGGTCGATTCAGATA Chr5:3554733..3554752 60.04 50
downstream ENSMUSE00000184909 Chr5:3557744..3557822 CCTTGGAGCCCTTCTTTTTC Chr5:3557793..3557812 60.18 50
downstream ENSMUSE00000184908 Chr5:3558473..3558547 TGGATGAGCTCTCATTTCCAC Chr5:3558538..3558558 60.21 47.62
downstream ENSMUSE00000496161 Chr5:3558661..3558693 No primer for this exon
downstream ENSMUSE00000497715 Chr5:3559097..3559159 TTCGGAATCTGAAGAACTGCT Chr5:3559155..3559175 59.07 42.86
downstream ENSMUSE00000720344 Chr5:3559606..3559698 TTATGGCAACGGCTCTTCTT Chr5:3559658..3559677 59.85 45
downstream ENSMUSE00000721940 Chr5:3559606..3559698 TTATGGCAACGGCTCTTCTT Chr5:3559658..3559677 59.85 45
downstream ENSMUSE00000405924 Chr5:3561039..3561089 No primer for this exon
downstream ENSMUSE00000703264 Chr5:3561039..3561089 No primer for this exon
downstream ENSMUSE00000365015 Chr5:3564241..3564327 CAGCGACTCAGATGACAACG Chr5:3564309..3564328 60.62 55
downstream ENSMUSE00000703262 Chr5:3564241..3564327 CAGCGACTCAGATGACAACG Chr5:3564309..3564328 60.62 55
downstream ENSMUSE00000405213 Chr5:3565703..3565750 No primer for this exon
downstream ENSMUSE00000703260 Chr5:3565703..3565750 No primer for this exon
downstream ENSMUSE00000656303 Chr5:3568987..3570548 CAGAGTCACCAAGCACTGGA Chr5:3569285..3569304 60.02 55
downstream ENSMUSE00000703257 Chr5:3568987..3569810 CAGAGTCACCAAGCACTGGA Chr5:3569285..3569304 60.02 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AATCGCGTGGTGAGTATTCG Chr5:3546940..3546960 61.05 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTAGGCGTGACTGGGAAAAC Chr5:3552994..3553014 60.11 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000058503