Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4921
Trapped Gene
Sft2d1 (ENSMUSG00000073468)
Vector Insertion
Chr 17: 8504151 - 8511708
Public Clones AN0062 (sanger) M123B03 (ggtc) (ggtc) 3SM123B03 (ggtc) IST10591G1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 15% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000658342 (Chr17:8504038..8504150 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAAGAGGACAGGGCTATGGA Chr17:8504073..8504092 60.21 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000658342 (Chr17:8504038..8504150 +)
Downstram Exon
ENSMUSE00000658341 (Chr17:8511709..8511795 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAAGAGGACAGGGCTATGGA Chr17:8504073..8504092 60.21 55 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000658342 Chr17:8504038..8504150 CAAGAGGACAGGGCTATGGA Chr17:8504073..8504092 60.21 55

*** Putative Vector Insertion (Chr 17: 8504151 - 8511708) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000658341 Chr17:8511709..8511795 No primer for this exon
downstream ENSMUSE00000658340 Chr17:8512284..8512366 GCAAGGTTTCCAAGGGTGTA Chr17:8512357..8512376 59.97 50
downstream ENSMUSE00000658339 Chr17:8513465..8513546 CACAGGTCCCATTAAAAAGCA Chr17:8513491..8513511 59.98 42.86
downstream ENSMUSE00000658338 Chr17:8514665..8514760 CTTACCCACAGAGCAGCACA Chr17:8514708..8514727 60.05 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGGCTGTGTGGCTGTAACTC Chr17:8510143..8510163 60.72 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCTGTGTGGCTGTAACTCTCC Chr17:8507145..8507166 59.93 57.14 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000073468