Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4931
Trapped Gene
OTTMUSG00000016569 (ENSMUSG00000078872)
Vector Insertion
Chr 2: 176859064 - 176864960
Public Clones (sanger) (sanger) (sanger) AM0488 (sanger) (sanger) (sanger)
RRO205 (baygenomics) YHA131 (baygenomics) P030H02 (ggtc) 3SH010C06 (ggtc)
3SD098H01 (ggtc) 3SD175B07 (ggtc) P017G06 (ggtc) 5SD129A09 (ggtc)
5SE284G03 (ggtc) D069E08 (ggtc) 5SH010C06 (ggtc) 5SD098H01 (ggtc)
5SD175B07 (ggtc) (egtc) IST12709E6 (tigm) IST12445C7 (tigm) IST10188G7 (tigm)
IST10664C5 (tigm) IST10098H5 (tigm) IST11054G2 (tigm) IST14234B10 (tigm)
IST11597H12 (tigm) IST10188G7 (tigm) IST11519H1 (tigm) IST10664C5 (tigm)
IST11583C5 (tigm) IST11829A1 (tigm) IST14140F5 (tigm) IST10513C10 (tigm)
IST11519H1 (tigm) IST13972E6 (tigm) IST10289H4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000678650 (Chr2:176859025..176859063 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGGTAGCTCAGGCAAGCTCA Chr2:176859030..176859049 60.3 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000678650 (Chr2:176859025..176859063 +)
Downstram Exon
ENSMUSE00000721056 (Chr2:176864961..176865024 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGGTAGCTCAGGCAAGCTCA Chr2:176859030..176859049 60.3 55 TTGCTAGGTCCCCTCACATC Chr2:176865008..176865027 60.07 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000678650 Chr2:176859025..176859063 AGGTAGCTCAGGCAAGCTCA Chr2:176859030..176859049 60.3 55

*** Putative Vector Insertion (Chr 2: 176859064 - 176864960) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000721056 Chr2:176864961..176865024 TTGCTAGGTCCCCTCACATC Chr2:176865008..176865027 60.07 55
downstream ENSMUSE00000678644 Chr2:176864970..176865024 TTGCTAGGTCCCCTCACATC Chr2:176865008..176865027 60.07 55
downstream ENSMUSE00000678649 Chr2:176868948..176869074 AAGCCCATTCTTCCTGAGTG Chr2:176869005..176869024 59.28 50
downstream ENSMUSE00000678643 Chr2:176869281..176869345 No primer for this exon
downstream ENSMUSE00000678647 Chr2:176869281..176869341 No primer for this exon
downstream ENSMUSE00000678642 Chr2:176871019..176871739 TCCGAGATGACTGCTTTGTG Chr2:176871355..176871374 59.98 50
downstream ENSMUSE00000678646 Chr2:176871019..176872052 GGTGTAAAGGCACCATTGCT Chr2:176872000..176872019 60 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCTTCTTAATCGCCTTGCAG Chr2:176862109..176862129 60.12 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGCTCAGGCAAGCTCAGAAC Chr2:176862035..176862055 59.9 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000078872