Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4937
Trapped Gene
Sdccag3 (ENSMUSG00000026927)
Vector Insertion
Chr 2: 26242832 - 26243075
Public Clones AM0868 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 52% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000164366 (Chr2:26243076..26243191 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACCTTGAAGAAGCCAATCCA Chr2:26243157..26243176 59.67 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000164366 (Chr2:26243076..26243191 -)
Downstram Exon
ENSMUSE00000717481 (Chr2:26242424..26242831 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACCTTGAAGAAGCCAATCCA Chr2:26243157..26243176 59.67 45 GAGTCTGATCCACGGCAGAT Chr2:26242632..26242651 60.23 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000518428 Chr2:26244669..26244806 No primer for this exon
upstream ENSMUSE00000569012 Chr2:26244436..26244481 GGCTTCGGTAGGAGACACAG Chr2:26244436..26244455 59.87 60
upstream ENSMUSE00000646640 Chr2:26244436..26244585 GGCCGACGTTTATGTGCTAT Chr2:26244473..26244492 59.99 50
upstream ENSMUSE00000698146 Chr2:26244106..26244214 GGACAAACGCTGCAGTCATA Chr2:26244124..26244143 59.87 50
upstream ENSMUSE00000164370 Chr2:26244012..26244080 TGGCTATGGAAAGGGGAAAT Chr2:26244057..26244076 60.63 45
upstream ENSMUSE00000164366 Chr2:26243076..26243191 ACCTTGAAGAAGCCAATCCA Chr2:26243157..26243176 59.67 45

*** Putative Vector Insertion (Chr 2: 26242832 - 26243075) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000646639 Chr2:26242451..26242831 GAGTCTGATCCACGGCAGAT Chr2:26242632..26242651 60.23 55
downstream ENSMUSE00000646638 Chr2:26242435..26242449 No primer for this exon
downstream ENSMUSE00000717481 Chr2:26242424..26242831 GAGTCTGATCCACGGCAGAT Chr2:26242632..26242651 60.23 55
downstream ENSMUSE00000717607 Chr2:26242424..26242831 GAGTCTGATCCACGGCAGAT Chr2:26242632..26242651 60.23 55
downstream ENSMUSE00000164369 Chr2:26241510..26241583 No primer for this exon
downstream ENSMUSE00000698144 Chr2:26241510..26241583 No primer for this exon
downstream ENSMUSE00000164371 Chr2:26241018..26241129 TCCAACTTCCGTTCGAGTGT Chr2:26241081..26241100 60.69 50
downstream ENSMUSE00000698142 Chr2:26241018..26241129 TCCAACTTCCGTTCGAGTGT Chr2:26241081..26241100 60.69 50
downstream ENSMUSE00000164367 Chr2:26240603..26240665 TCTGCTTTTACAGCCCGTTT Chr2:26240624..26240643 59.88 45
downstream ENSMUSE00000698139 Chr2:26240603..26240665 TCTGCTTTTACAGCCCGTTT Chr2:26240624..26240643 59.88 45
downstream ENSMUSE00000164364 Chr2:26240202..26240341 ACAAGGTGGAGGTTCTGCAA Chr2:26240207..26240226 60.69 50
downstream ENSMUSE00000698136 Chr2:26240202..26240341 ACAAGGTGGAGGTTCTGCAA Chr2:26240207..26240226 60.69 50
downstream ENSMUSE00000389151 Chr2:26238323..26239214 CACATTCGGAAGATGTGTGG Chr2:26239030..26239049 59.96 50
downstream ENSMUSE00000604883 Chr2:26238323..26239214 CACATTCGGAAGATGTGTGG Chr2:26239030..26239049 59.96 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000026927