Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4962
Trapped Gene
Ddx6 (ENSMUSG00000032097)
Vector Insertion
Chr 9: 44422400 - 44431701
Public Clones AJ0034 (sanger) RRS246 (baygenomics) RRS266 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 25% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000216526 (Chr9:44422295..44422399 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GATGTGACCTCCACAAAAGGA Chr9:44422295..44422315 59.96 47.62 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000216526 (Chr9:44422295..44422399 +)
Downstram Exon
ENSMUSE00000216525 (Chr9:44431702..44431831 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GATGTGACCTCCACAAAAGGA Chr9:44422295..44422315 59.96 47.62 TCAGGTCCAGCCTTTCAAGT Chr9:44431816..44431835 59.84 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000435404 Chr9:44412979..44413035 GGGAGCTTCGAGTCAACAAT Chr9:44412979..44412998 59.29 50
upstream ENSMUSE00000260519 Chr9:44415206..44415675 CCTGTGCAGCTAACAAAGCA Chr9:44415457..44415476 60.19 50
upstream ENSMUSE00000216524 Chr9:44420911..44420974 ACCTGGTGATGACTGGAAAAA Chr9:44420911..44420931 59.44 42.86
upstream ENSMUSE00000216526 Chr9:44422295..44422399 GATGTGACCTCCACAAAAGGA Chr9:44422295..44422315 59.96 47.62

*** Putative Vector Insertion (Chr 9: 44422400 - 44431701) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000216525 Chr9:44431702..44431831 TCAGGTCCAGCCTTTCAAGT Chr9:44431816..44431835 59.84 50
downstream ENSMUSE00000216535 Chr9:44432558..44432704 TGACCTGGATGCAAATCTGA Chr9:44432623..44432642 60.2 45
downstream ENSMUSE00000216528 Chr9:44434471..44434565 CCACGCCTTTCTTGATGAGA Chr9:44434530..44434549 61.32 50
downstream ENSMUSE00000461271 Chr9:44435721..44435843 GCACAAAATCCTGTGACAACA Chr9:44435753..44435773 59.61 42.86
downstream ENSMUSE00000216533 Chr9:44436724..44436852 TTGAGGCAGTGCACTTTTTG Chr9:44436839..44436858 60.03 45
downstream ENSMUSE00000216531 Chr9:44438107..44438223 TGCAGAAAATGATGGACTGG Chr9:44438140..44438159 59.65 45
downstream ENSMUSE00000473047 Chr9:44439466..44439529 CAAACAAGATTGCGGCATAA Chr9:44439527..44439546 59.7 40
downstream ENSMUSE00000216530 Chr9:44442176..44442277 TAGGTCTCTGCCAGCTTTGG Chr9:44442257..44442276 60.53 55
downstream ENSMUSE00000216534 Chr9:44443766..44443948 AGGCTCTTGTCGATGTTGCT Chr9:44443895..44443914 60.02 50
downstream ENSMUSE00000637410 Chr9:44444572..44446427 CTTTACAGCGAGTGCCTTCC Chr9:44445445..44445464 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCTGGGAAAAACCATCTCCT Chr9:44425375..44425395 60.44 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCTGGGAAAAACCATCTCCT Chr9:44425375..44425395 60.44 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032097