Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4963
Trapped Gene
3300001P08Rik (ENSMUSG00000020863)
Vector Insertion
Chr 11: 94171006 - 94183003
Public Clones (sanger) AJ0032 (sanger) RRG157 (baygenomics) FHCRC-GT-S19-7C1 (fhcrc) IST12061F2 (tigm)
IST12061F2 (tigm) IST14507D11 (tigm) IST14677D5 (tigm)
Private Clones OST465929 (lexicon) OST465067 (lexicon) OST450163 (lexicon) OST448648 (lexicon)
OST340643 (lexicon) OST288263 (lexicon) OST191417 (lexicon) OST191182 (lexicon)
OST137302 (lexicon) OST129794 (lexicon) OST129698 (lexicon) OST112932 (lexicon)
OST90614 (lexicon) OST60571 (lexicon) OST30419 (lexicon) OST23230 (lexicon)
OST21027 (lexicon)
Severity of mutation (?) Insertion after 7% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000381021 (Chr11:94183004..94183225 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000381021 (Chr11:94183004..94183225 -)
Downstram Exon
ENSMUSE00000110620 (Chr11:94170939..94171005 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000381021 Chr11:94183004..94183225 No primer for this exon
upstream ENSMUSE00000674525 Chr11:94183004..94183302 No primer for this exon

*** Putative Vector Insertion (Chr 11: 94171006 - 94183003) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000110620 Chr11:94170939..94171005 No primer for this exon
downstream ENSMUSE00000110618 Chr11:94167500..94167539 No primer for this exon
downstream ENSMUSE00000110623 Chr11:94165156..94165300 No primer for this exon
downstream ENSMUSE00000110627 Chr11:94162819..94162893 No primer for this exon
downstream ENSMUSE00000110625 Chr11:94161270..94161374 No primer for this exon
downstream ENSMUSE00000110624 Chr11:94159073..94159234 No primer for this exon
downstream ENSMUSE00000110621 Chr11:94158198..94158481 No primer for this exon
downstream ENSMUSE00000110626 Chr11:94157234..94157394 No primer for this exon
downstream ENSMUSE00000110628 Chr11:94154452..94154592 No primer for this exon
downstream ENSMUSE00000674524 Chr11:94154399..94154592 No primer for this exon
downstream ENSMUSE00000674529 Chr11:94154241..94154346 No primer for this exon
downstream ENSMUSE00000674528 Chr11:94152844..94152892 No primer for this exon
downstream ENSMUSE00000365413 Chr11:94152454..94154346 No primer for this exon
downstream ENSMUSE00000674521 Chr11:94152453..94154592 No primer for this exon
downstream ENSMUSE00000674523 Chr11:94152453..94152892 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGGACCACGAGAGCGTAAGT Chr11:94170996..94171016 61.61 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTGTTTTCGTGACTGGGAAA Chr11:94170939..94170960 60.5 38.1 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 AGGGTTAAGAGGGCAGTGCT Chr11:94171232..94171252 60.27 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 AGGGTTAAGAGGGCAGTGCT Chr11:94171232..94171252 60.27 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020863