Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4977
Trapped Gene
1110021J02Rik (ENSMUSG00000024018)
Vector Insertion
Chr 17: 29842529 - 29853878
Public Clones XS0836 (sanger) D170D06 (ggtc) (ggtc) IST15045C11 (tigm) IST14754H2 (tigm)
Private Clones OST422847 (lexicon) OST378751 (lexicon) OST290472 (lexicon) OST280461 (lexicon)
OST271427 (lexicon) OST201866 (lexicon) OST194727 (lexicon) OST184488 (lexicon)
OST167794 (lexicon) OST148959 (lexicon) OST148941 (lexicon) OST104710 (lexicon)
OST63848 (lexicon) OST59798 (lexicon) OST59488 (lexicon) OST56670 (lexicon)
Severity of mutation (?) Insertion after 23% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000233744 (Chr17:29853879..29853939 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGAAGCGGGAGAATCTTGGT Chr17:29853891..29853910 60.21 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000233744 (Chr17:29853879..29853939 -)
Downstram Exon
ENSMUSE00000233708 (Chr17:29842434..29842528 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGAAGCGGGAGAATCTTGGT Chr17:29853891..29853910 60.21 50 AGCTCTGCCCTGTAAAGCTG Chr17:29842427..29842446 59.78 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000233744 Chr17:29853879..29853939 AGAAGCGGGAGAATCTTGGT Chr17:29853891..29853910 60.21 50
upstream ENSMUSE00000700077 Chr17:29853879..29853956 AGAAGCGGGAGAATCTTGGT Chr17:29853891..29853910 60.21 50

*** Putative Vector Insertion (Chr 17: 29842529 - 29853878) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000233708 Chr17:29842434..29842528 AGCTCTGCCCTGTAAAGCTG Chr17:29842427..29842446 59.78 55
downstream ENSMUSE00000137280 Chr17:29842216..29842268 GCTTTGTTCATGAGGGTGTG Chr17:29842205..29842224 59.14 50
downstream ENSMUSE00000416965 Chr17:29841315..29841414 CGTGTTCTTCCGGTTCTCAT Chr17:29841349..29841368 60.11 50
downstream ENSMUSE00000700076 Chr17:29840279..29841414 CTGGAGATGGCTGACTCACA Chr17:29841274..29841293 59.98 55
downstream ENSMUSE00000657871 Chr17:29837173..29837197 AGGGTGAAGGAGGTGTATCG Chr17:29837155..29837174 59.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGAAGTCGGGTTCGAGTCAC Chr17:29844848..29844868 59.31 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGAAGTCGGGTTCGAGTCAC Chr17:29844848..29844868 59.31 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TAATCGCCTTGCAGCACATC Chr17:29850869..29850889 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TGCGTAGTGCGACTTAATGG Chr17:29850951..29850971 59.9 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024018