Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI498
Trapped Gene
Trnt1 (ENSMUSG00000013736)
Vector Insertion
Chr 6: 106723473 - 106724399
Public Clones CH0841 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 53% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000235515 (Chr6:106723279..106723472 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000235515 (Chr6:106723279..106723472 +)
Downstram Exon
ENSMUSE00000235509 (Chr6:106724400..106724538 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000694884 Chr6:106719114..106719185 No primer for this exon
upstream ENSMUSE00000694887 Chr6:106719135..106719185 No primer for this exon
upstream ENSMUSE00000652606 Chr6:106719160..106719185 No primer for this exon
upstream ENSMUSE00000694892 Chr6:106719188..106719250 No primer for this exon
upstream ENSMUSE00000374784 Chr6:106719824..106719997 No primer for this exon
upstream ENSMUSE00000710023 Chr6:106719824..106719997 No primer for this exon
upstream ENSMUSE00000652605 Chr6:106719850..106719997 No primer for this exon
upstream ENSMUSE00000235515 Chr6:106723279..106723472 No primer for this exon

*** Putative Vector Insertion (Chr 6: 106723473 - 106724399) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000235509 Chr6:106724400..106724538 No primer for this exon
downstream ENSMUSE00000235499 Chr6:106726113..106726239 No primer for this exon
downstream ENSMUSE00000652604 Chr6:106726448..106726487 No primer for this exon
downstream ENSMUSE00000694883 Chr6:106726448..106727675 No primer for this exon
downstream ENSMUSE00000195153 Chr6:106727912..106728105 No primer for this exon
downstream ENSMUSE00000367430 Chr6:106728782..106729035 No primer for this exon
downstream ENSMUSE00000385276 Chr6:106729180..106729461 No primer for this exon
downstream ENSMUSE00000556857 Chr6:106731641..106732458 No primer for this exon
downstream ENSMUSE00000694885 Chr6:106731641..106731648 No primer for this exon
downstream ENSMUSE00000694886 Chr6:106731641..106731865 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCGTACTGGCTATGGCATTC Chr6:106723493..106723513 60.49 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCGTACTGGCTATGGCATTC Chr6:106723493..106723513 60.49 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000013736