Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4991
Trapped Gene
Stk38 (ENSMUSG00000024006)
Vector Insertion
Chr 17: 29109622 - 29109989
Public Clones YTC377 (baygenomics) A055C02 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 91% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000137176 (Chr17:29109990..29110084 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000137176 (Chr17:29109990..29110084 -)
Downstram Exon
ENSMUSE00000717891 (Chr17:29109182..29109621 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon AGGCCCTATTTTGCTGCTTT Chr17:29109464..29109483 60.22 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000431121 Chr17:29144656..29144882 GCAGTTGGGGTTCTTCCTTT Chr17:29144795..29144814 60.48 50
upstream ENSMUSE00000238312 Chr17:29136954..29137086 CAGGATCAACACCTTGCTCA Chr17:29137055..29137074 59.83 50
upstream ENSMUSE00000710202 Chr17:29136954..29137089 CAGGATCAACACCTTGCTCA Chr17:29137055..29137074 59.83 50
upstream ENSMUSE00000711234 Chr17:29136954..29137086 CAGGATCAACACCTTGCTCA Chr17:29137055..29137074 59.83 50
upstream ENSMUSE00000238301 Chr17:29129362..29129413 GAAGGCCTGAAAGACGAAGA Chr17:29129363..29129382 59.55 50
upstream ENSMUSE00000137178 Chr17:29128243..29128365 AGAACAAGGCTTGGACTGGA Chr17:29128289..29128308 59.84 50
upstream ENSMUSE00000137194 Chr17:29125123..29125206 AATGAAAATCCTGCGCAAAG Chr17:29125146..29125165 60.21 40
upstream ENSMUSE00000137186 Chr17:29121022..29121145 GCGGAGCGTGACATTCTAGT Chr17:29121111..29121130 60.43 55
upstream ENSMUSE00000137185 Chr17:29118977..29119131 No primer for this exon
upstream ENSMUSE00000549113 Chr17:29117330..29117467 AAGGCCCAGGATTCTTGTCT Chr17:29117438..29117457 60.07 50
upstream ENSMUSE00000137179 Chr17:29116148..29116250 ACTTTCCGACTTTGGCCTTT Chr17:29116220..29116239 60.11 45
upstream ENSMUSE00000137183 Chr17:29114485..29114546 GGAAAGCAGAGACCTGGAAA Chr17:29114503..29114522 59.4 50
upstream ENSMUSE00000137192 Chr17:29112764..29112881 TGCAGACGGGTTACAACAAG Chr17:29112813..29112832 59.76 50
upstream ENSMUSE00000137180 Chr17:29111491..29111614 CGAGACCCCACAAGAGACAT Chr17:29111576..29111595 60.11 55
upstream ENSMUSE00000238116 Chr17:29111227..29111322 TTCTGCTGTGAATGGGAACA Chr17:29111302..29111321 60.24 45
upstream ENSMUSE00000137176 Chr17:29109990..29110084 No primer for this exon

*** Putative Vector Insertion (Chr 17: 29109622 - 29109989) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000717891 Chr17:29109182..29109621 AGGCCCTATTTTGCTGCTTT Chr17:29109464..29109483 60.22 45
downstream ENSMUSE00000408447 Chr17:29107830..29109621 TAGGCAGTGTGTGCCTCAAG Chr17:29108677..29108696 60.05 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCTGCCACTGCAGTCTTTAG Chr17:29109956..29109976 58.83 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGCTGCCACTGCAGTCTTTA Chr17:29109957..29109977 61.51 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024006