Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4992
Trapped Gene
Prune (ENSMUSG00000015711)
Vector Insertion
Chr 3: 95063257 - 95066132
Public Clones YTB009 (baygenomics) YTB026 (baygenomics) YTC384 (baygenomics) YTB036 (baygenomics)
PST11851-NR (escells) PST2378-NR (escells)
Private Clones not available
Severity of mutation (?) Insertion after 50% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000253477 (Chr3:95066133..95066291 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000253477 (Chr3:95066133..95066291 -)
Downstram Exon
ENSMUSE00000176370 (Chr3:95063162..95063256 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000391391 Chr3:95085507..95085998 No primer for this exon
upstream ENSMUSE00000332225 Chr3:95072153..95072245 No primer for this exon
upstream ENSMUSE00000253496 Chr3:95069340..95069542 No primer for this exon
upstream ENSMUSE00000253487 Chr3:95067514..95067698 No primer for this exon
upstream ENSMUSE00000253477 Chr3:95066133..95066291 No primer for this exon

*** Putative Vector Insertion (Chr 3: 95063257 - 95066132) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000176370 Chr3:95063162..95063256 No primer for this exon
downstream ENSMUSE00000253465 Chr3:95061949..95062107 No primer for this exon
downstream ENSMUSE00000413523 Chr3:95057597..95059349 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATTTAATCGCCTTGCAGCAC Chr3:95066064..95066084 60.24 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GATTCGTGACTGGGAAAACC Chr3:95066065..95066085 59.39 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 ATAATCGCCTTGCAGCACAT Chr3:95066222..95066242 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GGAGGGTTCACTCACACACA Chr3:95063319..95063339 59.55 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000015711