Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4995
Trapped Gene
Patl1 (ENSMUSG00000046139)
Vector Insertion
Chr 19: 11988950 - 11994667
Public Clones YHB333 (baygenomics) YTC391 (baygenomics) YTC088 (baygenomics) YTC390 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 6% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000389794 (Chr19:11988838..11988949 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATTTCAAGGCCTGGGAGAAG Chr19:11988876..11988895 60.57 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000389794 (Chr19:11988838..11988949 +)
Downstram Exon
ENSMUSE00000345207 (Chr19:11994668..11994885 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATTTCAAGGCCTGGGAGAAG Chr19:11988876..11988895 60.57 50 GGTCACCCAACAAATCCATC Chr19:11994787..11994806 60.03 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000693777 Chr19:11986948..11987067 CCAAGAATGTTCCGCTACGA Chr19:11987047..11987066 61.16 50
upstream ENSMUSE00000389794 Chr19:11988838..11988949 ATTTCAAGGCCTGGGAGAAG Chr19:11988876..11988895 60.57 50

*** Putative Vector Insertion (Chr 19: 11988950 - 11994667) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000345207 Chr19:11994668..11994885 GGTCACCCAACAAATCCATC Chr19:11994787..11994806 60.03 50
downstream ENSMUSE00000408223 Chr19:11995295..11995375 GGATTCGCCTCAGAACTTCA Chr19:11995358..11995377 60.34 50
downstream ENSMUSE00000373145 Chr19:11995859..11996053 CCTTGGTAAAGCTCGCTCAG Chr19:11995960..11995979 60.15 55
downstream ENSMUSE00000383055 Chr19:11996957..11997058 GACACTGCAGAGCTGGTTTG Chr19:11997058..11997077 59.62 55
downstream ENSMUSE00000349276 Chr19:11997877..11997966 GTGCTCTCTGCAGGGGACTA Chr19:11997949..11997968 60.56 60
downstream ENSMUSE00000398510 Chr19:11998291..11998508 GAGACATTCGTCCAGGCTGT Chr19:11998315..11998334 60.27 55
downstream ENSMUSE00000364162 Chr19:11999627..11999716 CTCTAAACATTGGGGCCTGA Chr19:11999652..11999671 60.07 50
downstream ENSMUSE00000364770 Chr19:12004365..12004545 TCCTTCCGGAGATGATCTTG Chr19:12004442..12004461 60.15 50
downstream ENSMUSE00000351761 Chr19:12006023..12006146 CCTTCTTAGGGCCATCACCT Chr19:12006092..12006111 60.46 55
downstream ENSMUSE00000374690 Chr19:12006628..12006725 CAGTAAGCTTCCCCAACGAG Chr19:12006663..12006682 59.87 55
downstream ENSMUSE00000375350 Chr19:12008170..12008229 No primer for this exon
downstream ENSMUSE00000362172 Chr19:12010169..12010317 TGCCCCTCAGGTTGTCATAC Chr19:12010301..12010320 60.92 55
downstream ENSMUSE00000411914 Chr19:12011710..12011869 ATCTTGGGCATCCTTCTTGA Chr19:12011869..12011888 59.63 45
downstream ENSMUSE00000354966 Chr19:12014174..12014329 CTTGTTCTGGAGCACAGCAG Chr19:12014332..12014351 59.77 55
downstream ENSMUSE00000370438 Chr19:12017119..12017210 AGGAGCAGTGACAAGCCAAA Chr19:12017141..12017160 60.97 50
downstream ENSMUSE00000361436 Chr19:12017315..12017464 CTTGGGGGATCCGTAGAAGT Chr19:12017367..12017386 60.32 55
downstream ENSMUSE00000693745 Chr19:12017821..12019456 TAGGGAGCCGAGTCCCTTAT Chr19:12019016..12019035 60.05 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGTTGTATTAATCGCCTTGC Chr19:11988992..11989013 59.98 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGGTCAGGTGCAGTTGGTAA Chr19:11988935..11988955 60.95 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000046139