Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI4999
Trapped Gene
Tmem199 (ENSMUSG00000051232)
Vector Insertion
Chr 11: 78321934 - 78322154
Public Clones YTC395 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 67% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000369323 (Chr11:78322155..78322197 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCTCAGTGACCTGGGAAAGC Chr11:78322158..78322177 60.39 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000369323 (Chr11:78322155..78322197 -)
Downstram Exon
ENSMUSE00000396709 (Chr11:78321821..78321933 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCTCAGTGACCTGGGAAAGC Chr11:78322158..78322177 60.39 55 TGAAGATGGTGACGACCAGA Chr11:78321876..78321895 60.25 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000392995 Chr11:78325399..78325633 CTGCATCAGCACCTGAGAGA Chr11:78325404..78325423 60.29 55
upstream ENSMUSE00000367221 Chr11:78323850..78323923 GGCAGTGACATCTACTTTCCAG Chr11:78323870..78323891 58.87 50
upstream ENSMUSE00000394610 Chr11:78323227..78323316 TGCCCGGCTAGAGAAGATTA Chr11:78323283..78323302 59.94 50
upstream ENSMUSE00000369323 Chr11:78322155..78322197 TCTCAGTGACCTGGGAAAGC Chr11:78322158..78322177 60.39 55

*** Putative Vector Insertion (Chr 11: 78321934 - 78322154) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000396709 Chr11:78321821..78321933 TGAAGATGGTGACGACCAGA Chr11:78321876..78321895 60.25 50
downstream ENSMUSE00000350943 Chr11:78320558..78321307 TAGACCCCAAAATGGACCAG Chr11:78320914..78320933 59.78 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGGAAAGCAAGGTAAGGTG Chr11:78322145..78322165 60.1 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGGAAAGCAAGGTAAGGTG Chr11:78322145..78322165 60.1 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000051232