Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI5014
Trapped Gene
Gk5 (ENSMUSG00000041440)
Vector Insertion
Chr 9: 96055917 - 96071878
Public Clones (sanger) YTC431 (baygenomics) IST13105F6 (tigm) IST13098F8 (tigm)
Private Clones OST435847 (lexicon) OST435489 (lexicon)
Severity of mutation (?) Insertion after 69% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000233456 (Chr9:96055812..96055916 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGGAAGATTGGGCAAGAACT Chr9:96055832..96055851 59.67 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000233456 (Chr9:96055812..96055916 +)
Downstram Exon
ENSMUSE00000233429 (Chr9:96071879..96071973 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGGAAGATTGGGCAAGAACT Chr9:96055832..96055851 59.67 45 TCCACTAAACGACGGAACAA Chr9:96071970..96071989 59.17 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000718859 Chr9:96019794..96020031 GGGTCTGGCGTTTATAGCTC Chr9:96019808..96019827 58.81 55
upstream ENSMUSE00000530954 Chr9:96019851..96020031 CTGCCACGTCTATGACCAGA Chr9:96019980..96019999 59.85 55
upstream ENSMUSE00000386347 Chr9:96029420..96029513 CTCTGGGCTCAGTTTGTTGC Chr9:96029471..96029490 60.97 55
upstream ENSMUSE00000233618 Chr9:96033808..96033883 TTGTCGGTCTTGGCATATCA Chr9:96033832..96033851 60.07 45
upstream ENSMUSE00000369922 Chr9:96038164..96038257 AAGACCTAAGGGCAGCTGAA Chr9:96038202..96038221 59.08 50
upstream ENSMUSE00000410491 Chr9:96040958..96041089 TGCCACCTTAAGATTGACCTG Chr9:96041047..96041067 60.12 47.62
upstream ENSMUSE00000341880 Chr9:96046091..96046166 GTTGCTTTGGGACGATTGAT Chr9:96046119..96046138 59.94 45
upstream ENSMUSE00000233536 Chr9:96050635..96050696 GCCACGGATTATTCAAATGC Chr9:96050646..96050665 60.3 45
upstream ENSMUSE00000233514 Chr9:96050854..96050927 GCCTCCTGTGAAGGATACCA Chr9:96050907..96050926 60.07 55
upstream ENSMUSE00000233489 Chr9:96051155..96051215 ATTTGGCGTGCCTATACCAG Chr9:96051185..96051204 59.98 50
upstream ENSMUSE00000233470 Chr9:96053500..96053626 GGAGAGTGCTGCTTCGAGAC Chr9:96053527..96053546 60.29 60
upstream ENSMUSE00000233456 Chr9:96055812..96055916 TGGAAGATTGGGCAAGAACT Chr9:96055832..96055851 59.67 45

*** Putative Vector Insertion (Chr 9: 96055917 - 96071878) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000233429 Chr9:96071879..96071973 TCCACTAAACGACGGAACAA Chr9:96071970..96071989 59.17 45
downstream ENSMUSE00000233383 Chr9:96075109..96075212 TGGAGTGCTTCAAACCCATA Chr9:96075166..96075185 59.12 45
downstream ENSMUSE00000399664 Chr9:96076649..96076708 GATGTTCGTGACGGGAATCT Chr9:96076709..96076728 59.93 50
downstream ENSMUSE00000371960 Chr9:96077838..96077971 TTGTTACACACGCCTCCATC Chr9:96077864..96077883 59.57 50
downstream ENSMUSE00000530948 Chr9:96079340..96079488 CACCTCGTATTCCTGCCACT Chr9:96079431..96079450 60.13 55
downstream ENSMUSE00000693797 Chr9:96079340..96079425 GCCACTTCTTCTGAGGCTTG Chr9:96079417..96079436 60.13 55
downstream ENSMUSE00000693795 Chr9:96079755..96079760 No primer for this exon
downstream ENSMUSE00000713790 Chr9:96082191..96085046 TCAATGTTGCAAGGTGTGGT Chr9:96082492..96082511 60.01 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr9:96061968..96061988 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGTTCTCGTGACTGGGAAA Chr9:96070961..96070981 58.85 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000041440