Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI5022
Trapped Gene
AC113019.13 (ENSMUSG00000078669)
Vector Insertion
Chr 7: 82600635 - 82679693
Public Clones (sanger) YTC453 (baygenomics) E079D10 (ggtc) IST14362D4 (tigm) IST10062B2 (tigm)
IST14523A10 (tigm) IST14271C8 (tigm)
Private Clones OST172782 (lexicon) OST170928 (lexicon) OST96521 (lexicon) OST68682 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000634167 (Chr7:82600443..82600634 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTCTTGGGCTCGGTTGAGAC Chr7:82600486..82600505 62.28 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000634167 (Chr7:82600443..82600634 +)
Downstram Exon
ENSMUSE00000634166 (Chr7:82679694..82679737 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTCTTGGGCTCGGTTGAGAC Chr7:82600486..82600505 62.28 60 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000634167 Chr7:82600443..82600634 CTCTTGGGCTCGGTTGAGAC Chr7:82600486..82600505 62.28 60

*** Putative Vector Insertion (Chr 7: 82600635 - 82679693) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000634166 Chr7:82679694..82679737 No primer for this exon
downstream ENSMUSE00000634165 Chr7:82714770..82714917 GACTTTCCGGGTACTTGTGC Chr7:82714889..82714908 59.6 55
downstream ENSMUSE00000634163 Chr7:82724388..82724684 CAGGTGTCTGAATGCCAGTG Chr7:82724638..82724657 60.31 55
downstream ENSMUSE00000634162 Chr7:82731043..82731226 CCTTCCTTGTTGTGGATGCT Chr7:82731166..82731185 60.11 50
downstream ENSMUSE00000634161 Chr7:82747672..82748187 ATGGGGTTCACGATGTGACT Chr7:82747810..82747829 60.25 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGGATTCAGGTGAGCAGTT Chr7:82642594..82642614 60.66 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGGATTCAGGTGAGCAGTT Chr7:82642594..82642614 60.66 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000078669