Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI5024
Trapped Gene
Blcap (ENSMUSG00000067787)
Vector Insertion
Chr 2: 157384064 - 157391983
Public Clones YTC455 (baygenomics) YHB395 (baygenomics) KST271 (baygenomics) IST14378D9 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000680633 (Chr2:157391984..157392097 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGAGCTAAGGTGGAGGCAAG Chr2:157392034..157392053 62.33 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000680633 (Chr2:157391984..157392097 -)
Downstram Exon
ENSMUSE00000680632 (Chr2:157382098..157384063 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGAGCTAAGGTGGAGGCAAG Chr2:157392034..157392053 62.33 60 AGACCACCCACGACTACAGG Chr2:157383396..157383415 60.03 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000680633 Chr2:157391984..157392097 CGAGCTAAGGTGGAGGCAAG Chr2:157392034..157392053 62.33 60
upstream ENSMUSE00000552744 Chr2:157391956..157392097 CGAGCTAAGGTGGAGGCAAG Chr2:157392034..157392053 62.33 60

*** Putative Vector Insertion (Chr 2: 157384064 - 157391983) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000552739 Chr2:157382099..157384063 AGACCACCCACGACTACAGG Chr2:157383396..157383415 60.03 60
downstream ENSMUSE00000680632 Chr2:157382098..157384063 AGACCACCCACGACTACAGG Chr2:157383396..157383415 60.03 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGCCGATGATGAGCAGTTCT Chr2:157391949..157391969 59.98 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTAACCAAGAAAGGGCGTGA Chr2:157391927..157391947 60.24 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 ATTGGGATAGGATGGGTTGG Chr2:157392083..157392103 60.77 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 ATTGGGATAGGATGGGTTGG Chr2:157392083..157392103 60.77 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000067787