Warning: Division by zero in /data/apache/unitrap.crg.es/htdocs/pcr.php on line 116
CBM UniTrap Project

Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI5037
Trapped Gene
AC121785.3 (ENSMUSG00000069014)
Vector Insertion
Chr 3: 54286054 - 54286236
Public Clones YTC491 (baygenomics) STA016 (baygenomics) P116C10 (ggtc) M028A02 (ggtc)
P135A12 (ggtc) M120H03 (ggtc) P135B01 (ggtc) M028D02 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000568193 (Chr3:54285388..54286053 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGGCAACTTTATGGGTCGT Chr3:54285980..54285999 59.99 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000568193 (Chr3:54285388..54286053 +)
Downstram Exon
ENSMUSE00000568192 (Chr3:54286237..54286461 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGGCAACTTTATGGGTCGT Chr3:54285980..54285999 59.99 50 CACCACTTCCACCTCCAGAT Chr3:54286441..54286460 59.96 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000568193 Chr3:54285388..54286053 CTGGCAACTTTATGGGTCGT Chr3:54285980..54285999 59.99 50

*** Putative Vector Insertion (Chr 3: 54286054 - 54286236) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000568192 Chr3:54286237..54286461 CACCACTTCCACCTCCAGAT Chr3:54286441..54286460 59.96 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr3:54286105..54286125 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000069014