Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI5038
Trapped Gene
AL805912.5 (ENSMUSG00000060989)
Vector Insertion
Chr 4: 12160691 - 12160855
Public Clones STA016 (baygenomics) YTC491 (baygenomics) P116C10 (ggtc) P135A12 (ggtc)
M120H03 (ggtc) P135B01 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 75% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000471687 (Chr4:12159935..12160690 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGGCAACTTTATGGGTCGT Chr4:12160638..12160657 59.99 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000471687 (Chr4:12159935..12160690 +)
Downstram Exon
ENSMUSE00000676210 (Chr4:12160856..12161837 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGGCAACTTTATGGGTCGT Chr4:12160638..12160657 59.99 50 TCCTGACAACTCCTCGCTCT Chr4:12161158..12161177 60.13 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000471687 Chr4:12159935..12160690 CTGGCAACTTTATGGGTCGT Chr4:12160638..12160657 59.99 50

*** Putative Vector Insertion (Chr 4: 12160691 - 12160855) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000676210 Chr4:12160856..12161837 TCCTGACAACTCCTCGCTCT Chr4:12161158..12161177 60.13 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr4:12160742..12160762 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000060989