Warning: Division by zero in /data/apache/unitrap.crg.es/htdocs/pcr.php on line 116
CBM UniTrap Project

Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI5039
Trapped Gene
AL844863.7 (ENSMUSG00000067669)
Vector Insertion
Chr X: 77702744 - 77702926
Public Clones STA016 (baygenomics) YTC491 (baygenomics) M028D02 (ggtc) P116C10 (ggtc)
M028A02 (ggtc) P135A12 (ggtc) M120H03 (ggtc) P135B01 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000550653 (ChrX:77702078..77702743 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGGCAACTTTATGGGTCGT ChrX:77702670..77702689 59.99 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000550653 (ChrX:77702078..77702743 +)
Downstram Exon
ENSMUSE00000550652 (ChrX:77702927..77703151 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGGCAACTTTATGGGTCGT ChrX:77702670..77702689 59.99 50 CACCACTTCCACCTCCAGAT ChrX:77703131..77703150 59.96 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000550653 ChrX:77702078..77702743 CTGGCAACTTTATGGGTCGT ChrX:77702670..77702689 59.99 50

*** Putative Vector Insertion (Chr X: 77702744 - 77702926) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000550652 ChrX:77702927..77703151 CACCACTTCCACCTCCAGAT ChrX:77703131..77703150 59.96 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000067669