Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI5053
Trapped Gene
Zcchc8 (ENSMUSG00000029427)
Vector Insertion
Chr 5: 124151132 - 124152571
Public Clones YTC518 (baygenomics) XG078 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 64% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000326165 (Chr5:124152572..124152689 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTCCAAAGAAGCAGCGAAAG Chr5:124152618..124152637 60.13 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000326165 (Chr5:124152572..124152689 -)
Downstram Exon
ENSMUSE00000326156 (Chr5:124149808..124151131 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTCCAAAGAAGCAGCGAAAG Chr5:124152618..124152637 60.13 50 GGAACATCTGAGTCGCCATT Chr5:124150821..124150840 60.08 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000326258 Chr5:124170730..124170949 GTGGATTTTGGCGACCTAGA Chr5:124170908..124170927 60.07 50
upstream ENSMUSE00000326250 Chr5:124169501..124169541 No primer for this exon
upstream ENSMUSE00000326239 Chr5:124166993..124167067 No primer for this exon
upstream ENSMUSE00000326234 Chr5:124164634..124164739 No primer for this exon
upstream ENSMUSE00000326228 Chr5:124164075..124164152 GGAAGAATCATGTGCCGTTA Chr5:124164098..124164117 58.57 45
upstream ENSMUSE00000326221 Chr5:124159391..124159494 CTCAGCTTACGGAAGGATGG Chr5:124159402..124159421 59.83 55
upstream ENSMUSE00000326216 Chr5:124159204..124159269 AAGGGCAAGAGATGCAAGTG Chr5:124159215..124159234 60.4 50
upstream ENSMUSE00000326211 Chr5:124158581..124158641 AGATGAAGGAATGCCCAATG Chr5:124158581..124158600 59.89 45
upstream ENSMUSE00000326204 Chr5:124158001..124158143 TGCTCGGATCAGTGAGAAGA Chr5:124158113..124158132 59.66 50
upstream ENSMUSE00000326196 Chr5:124157278..124157420 CAAGATGCACTGGGTGTGAC Chr5:124157391..124157410 60.16 55
upstream ENSMUSE00000188808 Chr5:124154532..124154650 GCTGATGGGGAAACAGAAAC Chr5:124154626..124154645 59.53 50
upstream ENSMUSE00000326178 Chr5:124153002..124153088 GTTCGGTTCCATACCAATGC Chr5:124153058..124153077 60.2 50
upstream ENSMUSE00000326165 Chr5:124152572..124152689 GTCCAAAGAAGCAGCGAAAG Chr5:124152618..124152637 60.13 50

*** Putative Vector Insertion (Chr 5: 124151132 - 124152571) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000326156 Chr5:124149808..124151131 GGAACATCTGAGTCGCCATT Chr5:124150821..124150840 60.08 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGCCGACATGGAGCTAGAC Chr5:124152574..124152594 60.97 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000029427