Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI5073
Trapped Gene
Farsa (ENSMUSG00000003808)
Vector Insertion
Chr 8: 87388259 - 87388335
Public Clones YTC563 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 86% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000211812 (Chr8:87388130..87388258 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000211812 (Chr8:87388130..87388258 +)
Downstram Exon
ENSMUSE00000482774 (Chr8:87388336..87388451 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000371902 Chr8:87380908..87381080 No primer for this exon
upstream ENSMUSE00000606618 Chr8:87380916..87381080 No primer for this exon
upstream ENSMUSE00000681426 Chr8:87380923..87381080 No primer for this exon
upstream ENSMUSE00000211814 Chr8:87384805..87384942 No primer for this exon
upstream ENSMUSE00000211815 Chr8:87385026..87385124 No primer for this exon
upstream ENSMUSE00000211806 Chr8:87385211..87385329 No primer for this exon
upstream ENSMUSE00000211807 Chr8:87387957..87388049 No primer for this exon
upstream ENSMUSE00000211812 Chr8:87388130..87388258 No primer for this exon

*** Putative Vector Insertion (Chr 8: 87388259 - 87388335) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000482774 Chr8:87388336..87388451 No primer for this exon
downstream ENSMUSE00000606617 Chr8:87388336..87390925 No primer for this exon
downstream ENSMUSE00000211809 Chr8:87391276..87391360 No primer for this exon
downstream ENSMUSE00000361228 Chr8:87391448..87391547 No primer for this exon
downstream ENSMUSE00000398063 Chr8:87391649..87391817 No primer for this exon
downstream ENSMUSE00000681438 Chr8:87391652..87391817 No primer for this exon
downstream ENSMUSE00000211811 Chr8:87391908..87391985 No primer for this exon
downstream ENSMUSE00000211810 Chr8:87392123..87392237 No primer for this exon
downstream ENSMUSE00000211813 Chr8:87392765..87393156 No primer for this exon
downstream ENSMUSE00000681445 Chr8:87392765..87393155 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCAAGGTCCGCTCTCAGTTC Chr8:87388217..87388237 60.53 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCAAGGTCCGCTCTCAGTTC Chr8:87388217..87388237 60.53 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000003808