Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI5091
Trapped Gene
Cep68 (ENSMUSG00000044066)
Vector Insertion
Chr 11: 20130598 - 20136008
Public Clones (sanger) (sanger) XC762 (baygenomics) YTC650 (baygenomics) (ggtc)
IST12355F11 (tigm) IST11551C6 (tigm) IST11991F10 (tigm) IST12720E6 (tigm)
IST10231F2 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000440688 (Chr11:20136009..20136105 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCCCTGACAGAGAGCGTCTT Chr11:20136056..20136075 60.13 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000440688 (Chr11:20136009..20136105 -)
Downstram Exon
ENSMUSE00000706151 (Chr11:20130431..20130597 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCCCTGACAGAGAGCGTCTT Chr11:20136056..20136075 60.13 55 AAGATGATCTGCACGGCTCT Chr11:20130508..20130527 59.98 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000337123 Chr11:20149310..20149421 No primer for this exon
upstream ENSMUSE00000680880 Chr11:20149310..20149374 No primer for this exon
upstream ENSMUSE00000389471 Chr11:20141889..20142241 GAACCAGATCAGCCCCTACA Chr11:20142079..20142098 60.07 55
upstream ENSMUSE00000712621 Chr11:20141889..20142241 GAACCAGATCAGCCCCTACA Chr11:20142079..20142098 60.07 55
upstream ENSMUSE00000333483 Chr11:20139199..20140701 CTCCTCTCCCGAGTTGACTG Chr11:20140371..20140390 59.98 60
upstream ENSMUSE00000370638 Chr11:20138469..20138591 CAGGACCAGCCTTACAGGTC Chr11:20138495..20138514 59.72 60
upstream ENSMUSE00000680871 Chr11:20138389..20138591 CAGGACCAGCCTTACAGGTC Chr11:20138495..20138514 59.72 60
upstream ENSMUSE00000440688 Chr11:20136009..20136105 TCCCTGACAGAGAGCGTCTT Chr11:20136056..20136075 60.13 55

*** Putative Vector Insertion (Chr 11: 20130598 - 20136008) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000706151 Chr11:20130431..20130597 AAGATGATCTGCACGGCTCT Chr11:20130508..20130527 59.98 50
downstream ENSMUSE00000440702 Chr11:20130427..20130597 AAGATGATCTGCACGGCTCT Chr11:20130508..20130527 59.98 50
downstream ENSMUSE00000655325 Chr11:20128509..20129484 AAAGACTCCCCGCTTTTCAT Chr11:20128787..20128806 60.07 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTTGGATAACACCCCAGGT Chr11:20133005..20133025 60.09 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGGCCTGTTTTGAACGTGAC Chr11:20132951..20132971 60.16 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TCTTAATCGCCTTGCAGCAC Chr11:20133038..20133058 61.44 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TACACGTGACTGGGAAAACC Chr11:20133039..20133059 58.47 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000044066