Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI5102
Trapped Gene
Glis2 (ENSMUSG00000014303)
Vector Insertion
Chr 16: 4608819 - 4610257
Public Clones YTC730 (baygenomics) CMHD-GT_535F7-3 (cmhd)
Private Clones OST390381 (lexicon) OST311855 (lexicon)
Severity of mutation (?) Insertion after 11% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000345578 (Chr16:4608598..4608818 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000345578 (Chr16:4608598..4608818 +)
Downstram Exon
ENSMUSE00000127807 (Chr16:4610258..4610430 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000512864 Chr16:4594713..4594935 No primer for this exon
upstream ENSMUSE00000345578 Chr16:4608598..4608818 No primer for this exon

*** Putative Vector Insertion (Chr 16: 4608819 - 4610257) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000127807 Chr16:4610258..4610430 No primer for this exon
downstream ENSMUSE00000127809 Chr16:4611280..4611456 No primer for this exon
downstream ENSMUSE00000127808 Chr16:4611533..4611666 No primer for this exon
downstream ENSMUSE00000127810 Chr16:4611751..4611869 No primer for this exon
downstream ENSMUSE00000375737 Chr16:4613386..4615957 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGGTACTTCACCCGTCAGC Chr16:4608817..4608837 60.71 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGGTACTTCACCCGTCAGC Chr16:4608817..4608837 60.71 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000014303