Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI5107
Trapped Gene
Chmp4b (ENSMUSG00000038467)
Vector Insertion
Chr 2: 154483108 - 154515253
Public Clones CSI382 (baygenomics) XH256 (baygenomics) YTC243 (baygenomics) CSH559 (baygenomics)
YTC328 (baygenomics) YHD117 (baygenomics) A011E03 (ggtc) (ggtc)
A012B02 (ggtc) W014B08 (ggtc) CMHD-GT_475D1-3 (cmhd) CMHD-GT_485H3-3 (cmhd)
CMHD-GT_481D12-3 (cmhd) FHCRC-GT-S16-10H1_H10 (fhcrc) IST14849D11 (tigm)
IST14857C10 (tigm) IST11388F8 (tigm) IST10390A3 (tigm) IST14826C12 (tigm)
IST13000C12 (tigm)
Private Clones OST364426 (lexicon) OST167903 (lexicon) OST97699 (lexicon) OST55551 (lexicon)
OST45398 (lexicon) OST43671 (lexicon)
Severity of mutation (?) Insertion after 28% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000393896 (Chr2:154482797..154483107 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAATCGAACAGGAGCTGACG Chr2:154483054..154483073 60.4 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000393896 (Chr2:154482797..154483107 +)
Downstram Exon
ENSMUSE00000385985 (Chr2:154515254..154515431 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAATCGAACAGGAGCTGACG Chr2:154483054..154483073 60.4 50 ACAGGGTGCCATCAATTTGT Chr2:154515325..154515344 60.24 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000393896 Chr2:154482797..154483107 AAATCGAACAGGAGCTGACG Chr2:154483054..154483073 60.4 50

*** Putative Vector Insertion (Chr 2: 154483108 - 154515253) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000385985 Chr2:154515254..154515431 ACAGGGTGCCATCAATTTGT Chr2:154515325..154515344 60.24 45
downstream ENSMUSE00000327058 Chr2:154516946..154517060 ACTCTTCTCCAAAGCCCACA Chr2:154517055..154517074 59.84 50
downstream ENSMUSE00000327052 Chr2:154518285..154518411 TACGGAGGGGACATTTGGTA Chr2:154518395..154518414 60.18 50
downstream ENSMUSE00000399652 Chr2:154519680..154520001 CATGCTATGCGAGAGTGAGC Chr2:154519906..154519925 59.73 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTTCAGCACTCCTGCCTGTA Chr2:154486095..154486115 59.19 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTTCAGCACTCCTGCCTGTA Chr2:154486095..154486115 59.19 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038467