Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI5116
Trapped Gene
Rnf26 (ENSMUSG00000053128)
Vector Insertion
Chr 9: 43918867 - 43920167
Public Clones YTC263 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000584622 (Chr9:43920044..43920166 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GATCCAGCCACAGGACACTC Chr9:43920051..43920070 60.69 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000584622 (Chr9:43920044..43920166 -)
Downstram Exon
ENSMUSE00000351040 (Chr9:43918868..43920782 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GATCCAGCCACAGGACACTC Chr9:43920051..43920070 60.69 60 CCTAGTGGAAGGCGAGTCAG Chr9:43920163..43920182 60.01 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000700740 Chr9:43921216..43921556 TCCTAACGCTGAGGTGCTTC Chr9:43921289..43921308 60.54 55
upstream ENSMUSE00000584623 Chr9:43920610..43921032 GGCCTTAGTTGAAGCTGTGG Chr9:43920816..43920835 59.88 55
upstream ENSMUSE00000584622 Chr9:43920044..43920166 GATCCAGCCACAGGACACTC Chr9:43920051..43920070 60.69 60
upstream ENSMUSE00000464460 Chr9:43919525..43921600 CCCTGTTTACCATCGCAACT Chr9:43919808..43919827 59.99 50
upstream ENSMUSE00000351040 Chr9:43918868..43920782 CCCTGTTTACCATCGCAACT Chr9:43919808..43919827 59.99 50

*** Putative Vector Insertion (Chr 9: 43918867 - 43920167) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000700736 Chr9:43906484..43906677 ATGCCTCTGCTGTCGAATCT Chr9:43906558..43906577 59.98 50
downstream ENSMUSE00000700735 Chr9:43903714..43904276 CTGTAGGCATTGGAACAGCA Chr9:43904130..43904149 59.86 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGACTCGCCTTCCACTAGGT Chr9:43920182..43920202 59.87 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGACTCGCCTTCCACTAGGT Chr9:43920182..43920202 59.87 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000053128