Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI5118
Trapped Gene
Bclaf1 (ENSMUSG00000037608)
Vector Insertion
Chr 10: 20037918 - 20041808
Public Clones RRH021 (baygenomics) YTC269 (baygenomics) E077C10 (ggtc) PST13416-NR (escells)
PST12495-NR (escells) PST4591-NL (escells) PST4591-NR (escells) PSTVU02.9N (vanderbilt)
Private Clones OST203713 (lexicon) OST174837 (lexicon) OST168035 (lexicon) OST148662 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000099625 (Chr10:20037814..20037917 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000099625 (Chr10:20037814..20037917 +)
Downstram Exon
ENSMUSE00000099624 (Chr10:20041809..20041922 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000484704 Chr10:20032275..20032410 GAAATGGCCGCTGTGTAGTT Chr10:20032345..20032364 60.14 50
upstream ENSMUSE00000705467 Chr10:20032278..20032410 GAAATGGCCGCTGTGTAGTT Chr10:20032345..20032364 60.14 50
upstream ENSMUSE00000099625 Chr10:20037814..20037917 No primer for this exon

*** Putative Vector Insertion (Chr 10: 20037918 - 20041808) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000099624 Chr10:20041809..20041922 No primer for this exon
downstream ENSMUSE00000412631 Chr10:20042769..20043674 TTCTTCGTGATGGGATGTGA Chr10:20043562..20043581 60.05 45
downstream ENSMUSE00000487284 Chr10:20042775..20043674 TTCTTCGTGATGGGATGTGA Chr10:20043562..20043581 60.05 45
downstream ENSMUSE00000615778 Chr10:20044946..20045611 CCTCCTCAGTATTCCGGTGA Chr10:20045232..20045251 60.06 55
downstream ENSMUSE00000615777 Chr10:20045736..20045905 CAGAATGGACAAGCGTGCTA Chr10:20045791..20045810 60.01 50
downstream ENSMUSE00000615776 Chr10:20047908..20048013 TGTATCTCGGGGCTCTTTTG Chr10:20048013..20048032 60.21 50
downstream ENSMUSE00000615775 Chr10:20049116..20049200 CGCTGGGAGAGATGTCAATC Chr10:20049141..20049160 60.77 55
downstream ENSMUSE00000615774 Chr10:20051892..20052067 GGAATCTCCCCGCTCTTTAC Chr10:20051984..20052003 60.04 55
downstream ENSMUSE00000577177 Chr10:20052202..20052363 TCCAACCTCCTGATGTAGCC Chr10:20052333..20052352 60.07 55
downstream ENSMUSE00000577184 Chr10:20053198..20053378 ATGGTCCCGCTCTCTACCTT Chr10:20053228..20053247 60.1 55
downstream ENSMUSE00000705466 Chr10:20053198..20053378 ATGGTCCCGCTCTCTACCTT Chr10:20053228..20053247 60.1 55
downstream ENSMUSE00000577183 Chr10:20054305..20054451 TGTCCCAGCAAAAACTCCTC Chr10:20054355..20054374 60.23 50
downstream ENSMUSE00000577180 Chr10:20059515..20059727 TTCCTCTTTTGGCCCAGTAA Chr10:20059563..20059582 59.68 45
downstream ENSMUSE00000705465 Chr10:20059515..20059727 TTCCTCTTTTGGCCCAGTAA Chr10:20059563..20059582 59.68 45
downstream ENSMUSE00000577179 Chr10:20059858..20062307 AGGGGAGCATCATGCAATAC Chr10:20061332..20061351 59.92 50
downstream ENSMUSE00000705464 Chr10:20059858..20060072 TCTGCTCCCTGTTGCAATCT Chr10:20059891..20059910 60.94 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr10:20040969..20040989 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGAGAAACGTGACTGGGAAA Chr10:20037962..20037982 59.26 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037608