Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI5121
Trapped Gene
Shoc2 (ENSMUSG00000024976)
Vector Insertion
Chr 19: 54077637 - 54092038
Public Clones YTC340 (baygenomics) YTA350 (baygenomics) CSJ150 (baygenomics) YTC278 (baygenomics)
YTA247 (baygenomics) A054C03 (ggtc) A008F07 (ggtc)
Private Clones OST52067 (lexicon)
Severity of mutation (?) Insertion after 48% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000146797 (Chr19:54077499..54077636 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GACCTACTGGACCTCCCAGA Chr19:54077609..54077628 59.1 60 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000146797 (Chr19:54077499..54077636 +)
Downstram Exon
ENSMUSE00000146798 (Chr19:54092039..54092169 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GACCTACTGGACCTCCCAGA Chr19:54077609..54077628 59.1 60 CCAAGGCGATTTAAACTGGA Chr19:54092069..54092088 60.07 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000688724 Chr19:54019370..54019503 TCTCTGCTTTCCTGCCTGTC Chr19:54019463..54019482 60.68 55
upstream ENSMUSE00000354840 Chr19:54061944..54062873 AAGGGAAAGACGCCAAAGAT Chr19:54062307..54062326 60.07 45
upstream ENSMUSE00000146797 Chr19:54077499..54077636 GACCTACTGGACCTCCCAGA Chr19:54077609..54077628 59.1 60

*** Putative Vector Insertion (Chr 19: 54077637 - 54092038) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000146798 Chr19:54092039..54092169 CCAAGGCGATTTAAACTGGA Chr19:54092069..54092088 60.07 45
downstream ENSMUSE00000146794 Chr19:54100840..54101028 GATGGACCTCCCACTGGATA Chr19:54100925..54100944 59.74 55
downstream ENSMUSE00000146796 Chr19:54102208..54102330 GGTCCAAGTTCCAAAATCCA Chr19:54102255..54102274 59.77 45
downstream ENSMUSE00000146795 Chr19:54103959..54104096 CTCCAGCTTGTTCTCCTCCA Chr19:54104060..54104079 60.52 55
downstream ENSMUSE00000146799 Chr19:54104351..54104468 AGGTGCGTGAGGTTGGTAAG Chr19:54104427..54104446 60.17 55
downstream ENSMUSE00000391894 Chr19:54105558..54107621 TGCCAGCTGTTTCAACAAAG Chr19:54106362..54106381 60.03 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TACCACGTTAATCGCCTTGC Chr19:54077680..54077700 61.02 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATGTGGGGAGAAGGGAGGTA Chr19:54077640..54077660 60.7 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024976