Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI513
Trapped Gene
Fiz1 (ENSMUSG00000061374)
Vector Insertion
Chr 7: 4964625 - 4966226
Public Clones (sanger) (sanger) CF0714 (sanger) (sanger) E077B05 (ggtc) P149F06 (ggtc)
(ggtc) E077B05 (ggtc) E115G04 (ggtc) E062H01 (ggtc) CMHD-GT_366E4-3 (cmhd)
FHCRC-GT-S23-6B1 (fhcrc) IST14771A2 (tigm) IST14733G2 (tigm)
Private Clones OST438029 (lexicon) OST369785 (lexicon) OST281636 (lexicon) OST247032 (lexicon)
OST217441 (lexicon) OST129426 (lexicon) OST113021 (lexicon) OST65624 (lexicon)
OST62484 (lexicon) OST46148 (lexicon) OST31199 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000677251 (Chr7:4966227..4966254 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000677251 (Chr7:4966227..4966254 -)
Downstram Exon
ENSMUSE00000538380 (Chr7:4964280..4964624 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CTCTTGCCACATTCGCTACA Chr7:4964460..4964479 60.01 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000677251 Chr7:4966227..4966254 No primer for this exon

*** Putative Vector Insertion (Chr 7: 4964625 - 4966226) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000538380 Chr7:4964280..4964624 CTCTTGCCACATTCGCTACA Chr7:4964460..4964479 60.01 50
downstream ENSMUSE00000494517 Chr7:4958662..4960807 ATCTTCTTGCTACGGCTGGA Chr7:4959848..4959867 59.98 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTAAACAGGAAAGCGGACAGA Chr7:4966196..4966217 59.87 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTAAACAGGAAAGCGGACAGA Chr7:4966196..4966217 59.87 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GCCCAGAGGGAGGTGTAAGT Chr7:4966219..4966239 60.51 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GCCCAGAGGGAGGTGTAAGT Chr7:4966219..4966239 60.51 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000061374