Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI5139
Trapped Gene
2610027L16Rik (ENSMUSG00000019297)
Vector Insertion
Chr 14: 56368280 - 56368828
Public Clones YTC348 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 42% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000314004 (Chr14:56368169..56368279 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000314004 (Chr14:56368169..56368279 +)
Downstram Exon
ENSMUSE00000313999 (Chr14:56368829..56368970 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000347044 Chr14:56364560..56364857 No primer for this exon
upstream ENSMUSE00000391384 Chr14:56364998..56365447 No primer for this exon
upstream ENSMUSE00000314004 Chr14:56368169..56368279 No primer for this exon

*** Putative Vector Insertion (Chr 14: 56368280 - 56368828) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000313999 Chr14:56368829..56368970 No primer for this exon
downstream ENSMUSE00000124639 Chr14:56369890..56370082 No primer for this exon
downstream ENSMUSE00000124631 Chr14:56370895..56371035 No primer for this exon
downstream ENSMUSE00000124632 Chr14:56371374..56371499 No primer for this exon
downstream ENSMUSE00000124633 Chr14:56371649..56371885 No primer for this exon
downstream ENSMUSE00000124641 Chr14:56372097..56372202 No primer for this exon
downstream ENSMUSE00000648535 Chr14:56372478..56374337 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCTTTCTGAAGGACATTGCTG Chr14:56368260..56368281 60.01 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCTTTCTGAAGGACATTGCTG Chr14:56368260..56368281 60.01 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000019297