Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI5148
Trapped Gene
Cbfa2t2 (ENSMUSG00000038533)
Vector Insertion
Chr 2: 154262373 - 154262579
Public Clones RRF565 (baygenomics) CSI657 (baygenomics) XE736 (baygenomics) HMA219 (baygenomics)
YTC178 (baygenomics) RRI043 (baygenomics) CSI658 (baygenomics) XE801 (baygenomics)
RRR101 (baygenomics) CSJ088 (baygenomics) XG579 (baygenomics) CSH693 (baygenomics)
XG531 (baygenomics) P015B09 (ggtc) F009D03 (ggtc) P023A08 (ggtc)
W275A08 (ggtc) P066C01 (ggtc) W024G12 (ggtc) D016F07 (ggtc) P029B03 (ggtc)
W221E01 (ggtc) P022G02 (ggtc) W087B05 (ggtc) P025C12 (ggtc) W068E05 (ggtc)
P110C07 (ggtc) P011A09 (ggtc) A060B03 (ggtc) P022C12 (ggtc) W064F05 (ggtc)
P096B05 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 2% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000681333 (Chr2:154262271..154262372 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000681333 (Chr2:154262271..154262372 +)
Downstram Exon
ENSMUSE00000681316 (Chr2:154262580..154262784 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CTACCACTCGTCGCTCCAAT Chr2:154262742..154262761 60.28 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000639806 Chr2:154262217..154262372 No primer for this exon
upstream ENSMUSE00000712948 Chr2:154262254..154262372 No primer for this exon
upstream ENSMUSE00000722077 Chr2:154262254..154262372 No primer for this exon
upstream ENSMUSE00000681333 Chr2:154262271..154262372 No primer for this exon

*** Putative Vector Insertion (Chr 2: 154262373 - 154262579) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000681316 Chr2:154262580..154262784 CTACCACTCGTCGCTCCAAT Chr2:154262742..154262761 60.28 55
downstream ENSMUSE00000439463 Chr2:154326136..154326279 CGGTCCTCCAGGATTTATTG Chr2:154326254..154326273 59.38 50
downstream ENSMUSE00000681307 Chr2:154326136..154326279 CGGTCCTCCAGGATTTATTG Chr2:154326254..154326273 59.38 50
downstream ENSMUSE00000681306 Chr2:154330289..154330530 GAGGAAGCGTTTCAACTTGC Chr2:154330455..154330474 60 50
downstream ENSMUSE00000709093 Chr2:154330289..154330530 GAGGAAGCGTTTCAACTTGC Chr2:154330455..154330474 60 50
downstream ENSMUSE00000719439 Chr2:154330289..154330530 GAGGAAGCGTTTCAACTTGC Chr2:154330455..154330474 60 50
downstream ENSMUSE00000555056 Chr2:154336244..154336333 TGGAATCACAAATGGACGAA Chr2:154336327..154336346 59.9 40
downstream ENSMUSE00000712771 Chr2:154336244..154336333 TGGAATCACAAATGGACGAA Chr2:154336327..154336346 59.9 40
downstream ENSMUSE00000720844 Chr2:154336244..154336333 TGGAATCACAAATGGACGAA Chr2:154336327..154336346 59.9 40
downstream ENSMUSE00000555050 Chr2:154341553..154341734 GCAGGAGATGCGATACTGGT Chr2:154341677..154341696 60.25 55
downstream ENSMUSE00000681313 Chr2:154341553..154341734 GCAGGAGATGCGATACTGGT Chr2:154341677..154341696 60.25 55
downstream ENSMUSE00000681312 Chr2:154343445..154343698 GGTTCCCGATACAGGTGAGA Chr2:154343651..154343670 59.93 55
downstream ENSMUSE00000681332 Chr2:154343445..154343560 GCGGTTCAGGAGGAACTGTA Chr2:154343494..154343513 60.26 55
downstream ENSMUSE00000709120 Chr2:154343445..154343698 GGTTCCCGATACAGGTGAGA Chr2:154343651..154343670 59.93 55
downstream ENSMUSE00000720654 Chr2:154343445..154343698 GGTTCCCGATACAGGTGAGA Chr2:154343651..154343670 59.93 55
downstream ENSMUSE00000327832 Chr2:154346887..154346972 CCTTTCTGTCAAACGGTGGT Chr2:154346942..154346961 60.01 50
downstream ENSMUSE00000681330 Chr2:154346887..154346972 CCTTTCTGTCAAACGGTGGT Chr2:154346942..154346961 60.01 50
downstream ENSMUSE00000327825 Chr2:154349640..154349835 TAAACCGCCGTTTCCAATAG Chr2:154349754..154349773 59.96 45
downstream ENSMUSE00000681325 Chr2:154349640..154349835 TAAACCGCCGTTTCCAATAG Chr2:154349754..154349773 59.96 45
downstream ENSMUSE00000639805 Chr2:154350250..154350443 CAGACCGTGTGTTTTGCATC Chr2:154350339..154350358 60.16 50
downstream ENSMUSE00000327816 Chr2:154354573..154354641 CTGGTAAATTCCCGCTGAGA Chr2:154354597..154354616 60.21 50
downstream ENSMUSE00000681322 Chr2:154354573..154354641 CTGGTAAATTCCCGCTGAGA Chr2:154354597..154354616 60.21 50
downstream ENSMUSE00000327808 Chr2:154356958..154357148 CTGCTCCATTCGAGCTCTCT Chr2:154357076..154357095 59.85 55
downstream ENSMUSE00000681320 Chr2:154356958..154357148 CTGCTCCATTCGAGCTCTCT Chr2:154357076..154357095 59.85 55
downstream ENSMUSE00000681311 Chr2:154356961..154357148 CTGCTCCATTCGAGCTCTCT Chr2:154357076..154357095 59.85 55
downstream ENSMUSE00000681335 Chr2:154356961..154357148 CTGCTCCATTCGAGCTCTCT Chr2:154357076..154357095 59.85 55
downstream ENSMUSE00000505140 Chr2:154360620..154365092 GCCTGCTACCAGTCTTCAGG Chr2:154361292..154361311 60.01 60
downstream ENSMUSE00000681310 Chr2:154360620..154361490 GCCTGCTACCAGTCTTCAGG Chr2:154361292..154361311 60.01 60
downstream ENSMUSE00000681319 Chr2:154360620..154365090 GCCTGCTACCAGTCTTCAGG Chr2:154361292..154361311 60.01 60
downstream ENSMUSE00000681338 Chr2:154360620..154365090 GCCTGCTACCAGTCTTCAGG Chr2:154361292..154361311 60.01 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTAATCGCCTTGCAGCACAT Chr2:154262423..154262443 61.69 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000038533