Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI5170
Trapped Gene
Vprbp (ENSMUSG00000040325)
Vector Insertion
Chr 9: 106768031 - 106776386
Public Clones YTC090 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 60% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000583328 (Chr9:106767929..106768030 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGCAGAGGATGAGGATGAAG Chr9:106768000..106768019 59.76 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000583328 (Chr9:106767929..106768030 +)
Downstram Exon
ENSMUSE00000458724 (Chr9:106776387..106776639 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGCAGAGGATGAGGATGAAG Chr9:106768000..106768019 59.76 55 TCAGCTCCACCTCCTCATCT Chr9:106776630..106776649 59.94 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000459037 Chr9:106724307..106724422 GACCAGAGGCAGTGTGTGAG Chr9:106724350..106724369 59.44 60
upstream ENSMUSE00000710134 Chr9:106731392..106731509 AGCTCACTACCCTGCTGGAG Chr9:106731437..106731456 59.62 60
upstream ENSMUSE00000718309 Chr9:106731392..106731509 AGCTCACTACCCTGCTGGAG Chr9:106731437..106731456 59.62 60
upstream ENSMUSE00000530240 Chr9:106733189..106733265 No primer for this exon
upstream ENSMUSE00000691755 Chr9:106733189..106733265 No primer for this exon
upstream ENSMUSE00000530239 Chr9:106736480..106736553 GAGTGTATGCTGGGCCATTT Chr9:106736494..106736513 59.96 50
upstream ENSMUSE00000691754 Chr9:106736480..106736553 GAGTGTATGCTGGGCCATTT Chr9:106736494..106736513 59.96 50
upstream ENSMUSE00000530237 Chr9:106737847..106737960 AGAAACCGCAGTTGTCTTTCA Chr9:106737933..106737953 59.91 42.86
upstream ENSMUSE00000691753 Chr9:106737847..106737960 AGAAACCGCAGTTGTCTTTCA Chr9:106737933..106737953 59.91 42.86
upstream ENSMUSE00000530236 Chr9:106738892..106739029 CTGGGAGGTGCTATGGAAAA Chr9:106738967..106738986 60.07 50
upstream ENSMUSE00000691752 Chr9:106738892..106739029 CTGGGAGGTGCTATGGAAAA Chr9:106738967..106738986 60.07 50
upstream ENSMUSE00000530235 Chr9:106740530..106741039 CCCAGATCGTGTGTTTGTTG Chr9:106740886..106740905 60 50
upstream ENSMUSE00000691751 Chr9:106740530..106741039 CCCAGATCGTGTGTTTGTTG Chr9:106740886..106740905 60 50
upstream ENSMUSE00000530234 Chr9:106741363..106741464 No primer for this exon
upstream ENSMUSE00000691750 Chr9:106741363..106741464 No primer for this exon
upstream ENSMUSE00000530233 Chr9:106746467..106746625 CTATGGCTGCAACTGGTGTG Chr9:106746558..106746577 60.32 55
upstream ENSMUSE00000691749 Chr9:106746467..106746625 CTATGGCTGCAACTGGTGTG Chr9:106746558..106746577 60.32 55
upstream ENSMUSE00000530232 Chr9:106748990..106749169 GATGGTCTTCGTCGTCTGGT Chr9:106749143..106749162 60.12 55
upstream ENSMUSE00000691748 Chr9:106748990..106749169 GATGGTCTTCGTCGTCTGGT Chr9:106749143..106749162 60.12 55
upstream ENSMUSE00000530231 Chr9:106750112..106750321 ACCAGGGTGCACTTTTGAGT Chr9:106750143..106750162 59.62 50
upstream ENSMUSE00000691745 Chr9:106750112..106750321 ACCAGGGTGCACTTTTGAGT Chr9:106750143..106750162 59.62 50
upstream ENSMUSE00000530230 Chr9:106754269..106754438 GCCCAGCTCAGCTATATTGG Chr9:106754327..106754346 59.83 55
upstream ENSMUSE00000691744 Chr9:106754269..106754438 GCCCAGCTCAGCTATATTGG Chr9:106754327..106754346 59.83 55
upstream ENSMUSE00000530229 Chr9:106756501..106756625 TACTGTGCGTTTTGCTTTGG Chr9:106756507..106756526 59.91 45
upstream ENSMUSE00000634495 Chr9:106756501..106756625 TACTGTGCGTTTTGCTTTGG Chr9:106756507..106756526 59.91 45
upstream ENSMUSE00000530228 Chr9:106760155..106761418 ATGTGTCTCTCGCACGACTG Chr9:106760659..106760678 60.06 55
upstream ENSMUSE00000634494 Chr9:106760155..106761038 ATGTGTCTCTCGCACGACTG Chr9:106760659..106760678 60.06 55
upstream ENSMUSE00000691742 Chr9:106760155..106761418 ATGTGTCTCTCGCACGACTG Chr9:106760659..106760678 60.06 55
upstream ENSMUSE00000530227 Chr9:106761912..106762110 TTCCGGGAAGCTAATGAAGA Chr9:106761931..106761950 59.78 45
upstream ENSMUSE00000691741 Chr9:106761912..106762110 TTCCGGGAAGCTAATGAAGA Chr9:106761931..106761950 59.78 45
upstream ENSMUSE00000530226 Chr9:106762710..106762792 TCTGACATCTGCCACTTGGA Chr9:106762724..106762743 60.4 50
upstream ENSMUSE00000691740 Chr9:106762710..106762792 TCTGACATCTGCCACTTGGA Chr9:106762724..106762743 60.4 50
upstream ENSMUSE00000530225 Chr9:106763299..106763383 TCTCAGGATCGGGTCATAGG Chr9:106763342..106763361 60.03 55
upstream ENSMUSE00000691739 Chr9:106763299..106763383 TCTCAGGATCGGGTCATAGG Chr9:106763342..106763361 60.03 55
upstream ENSMUSE00000530224 Chr9:106765348..106765581 AGGCCATCCACAAGTTTGAC Chr9:106765493..106765512 59.97 50
upstream ENSMUSE00000583327 Chr9:106765348..106765581 AGGCCATCCACAAGTTTGAC Chr9:106765493..106765512 59.97 50
upstream ENSMUSE00000583330 Chr9:106765981..106766074 GGATCAATGCCGTGTTGTTT Chr9:106766025..106766044 60.76 45
upstream ENSMUSE00000583329 Chr9:106766847..106766951 TTTCGAACATTCAACGCAAC Chr9:106766915..106766934 59.71 40
upstream ENSMUSE00000530200 Chr9:106767344..106767435 No primer for this exon
upstream ENSMUSE00000530222 Chr9:106767362..106767435 No primer for this exon
upstream ENSMUSE00000583328 Chr9:106767929..106768030 GGCAGAGGATGAGGATGAAG Chr9:106768000..106768019 59.76 55

*** Putative Vector Insertion (Chr 9: 106768031 - 106776386) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000458724 Chr9:106776387..106776639 TCAGCTCCACCTCCTCATCT Chr9:106776630..106776649 59.94 55
downstream ENSMUSE00000409364 Chr9:106782265..106782758 GGGCCTAGTCCCTGTAGCTC Chr9:106782620..106782639 60.23 65
downstream ENSMUSE00000527242 Chr9:106782265..106782758 GGGCCTAGTCCCTGTAGCTC Chr9:106782620..106782639 60.23 65
downstream ENSMUSE00000634492 Chr9:106782634..106782714 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGCTTTGAGAAGCCTGTGC Chr9:106771058..106771078 59.76 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGCTTTGAGAAGCCTGTGC Chr9:106771058..106771078 59.76 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040325