Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI518
Trapped Gene
Arl15 (ENSMUSG00000042348)
Vector Insertion
Chr 13: 114584905 - 114712454
Public Clones CJ0030 (sanger) XR0035 (sanger) AR0908 (sanger) AN0298 (sanger)
(sanger) CB0283 (sanger) CF0775 (sanger) AD0364 (sanger) AR0334 (sanger)
AM0263 (sanger) (sanger) (sanger) CJ0494 (sanger) AC0487 (sanger)
AT0578 (sanger) AX0496 (sanger) (sanger) (sanger) CH0766 (sanger)
AD0111 (sanger) AV0743 (sanger) AL0759 (sanger) (sanger)
(sanger) AZ0332 (sanger) AZ0174 (sanger) AD0363 (sanger) AD0629 (sanger)
(sanger) (sanger) CJ0348 (sanger) CH0758 (sanger) AF0334 (sanger)
AW0416 (sanger) (sanger) CH0611 (sanger) AD0110 (sanger) AS1048 (sanger)
AR0554 (sanger) (sanger) (sanger) CJ0518 (sanger) AD0099 (sanger)
CD0008 (sanger) AX0497 (sanger) (sanger) (sanger) RRO112 (baygenomics)
XL531 (baygenomics) RRT324 (baygenomics) RRO121 (baygenomics) DTM013 (baygenomics)
RRF211 (baygenomics) RRK299 (baygenomics) NPX233 (baygenomics) P023D10 (ggtc)
W272B03 (ggtc) 5SE043A04 (ggtc) 5SD088E09 (ggtc) (ggtc)
P096D06 (ggtc) 5SE307E06 (ggtc) 3SD185F01 (ggtc) (ggtc)
D023D01 (ggtc) P007B06 (ggtc) 3SD078H11 (ggtc) 5SD105E05 (ggtc) (ggtc)
P023D07 (ggtc) W185D04 (ggtc) 3SE020G10 (ggtc) D054C02 (ggtc) Q022F08 (ggtc)
3SE307E06 (ggtc) 3SD150C11 (ggtc) (ggtc) D018B01 (ggtc) W244D06 (ggtc)
5SD054C02 (ggtc) 3SD105E05 (ggtc) (ggtc) P026G10 (ggtc) 5SD185F01 (ggtc)
P065D03 (ggtc) P015C04 (ggtc) 5SD078H11 (ggtc) 5SD119G07 (ggtc) (ggtc)
CMHD-GT_296A5-3 (cmhd) FHCRC-GT-S5-8A1 (fhcrc) (egtc) Ayu21-T275 (egtc)
(egtc) IST14699G5 (tigm) IST11112H5 (tigm) IST14871C11 (tigm) IST15109C11 (tigm)
IST14388E1 (tigm) IST10057A1 (tigm) IST14138F7 (tigm) IST14501G3 (tigm)
IST11388H10 (tigm) IST14578A4 (tigm) IST14582G2 (tigm) IST13074H11 (tigm)
IST14189D7 (tigm) IST12860G3 (tigm) IST14193D1 (tigm) IST13638G11 (tigm)
IST14375H2 (tigm) IST14190H10 (tigm) IST14667G7 (tigm) IST14815A4 (tigm)
IST14615H8 (tigm) IST11579A7 (tigm) IST14531A9 (tigm) IST10465F6 (tigm)
IST10831D1 (tigm) IST13631G5 (tigm) IST15101F2 (tigm) IST14471F11 (tigm)
IST14493F11 (tigm) IST10786D10 (tigm) IST14625D1 (tigm) IST12182H11 (tigm)
IST12109H11 (tigm) IST14477D3 (tigm) IST11526E1 (tigm) IST14699G5 (tigm)
IST14221A7 (tigm) IST10838D1 (tigm) IST14377C6 (tigm) IST14299C1 (tigm)
IST14974C4 (tigm) IST14340G5 (tigm) IST14654G8 (tigm) IST15058C1 (tigm)
IST14485H5 (tigm) IST14492B6 (tigm)
Private Clones OST263035 (lexicon) OST226091 (lexicon) OST138309 (lexicon) OST43080 (lexicon)
Severity of mutation (?) Insertion after 8% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000679583 (Chr13:114584767..114584904 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGGATAACTGAGGCGTTTCT Chr13:114584869..114584888 59.34 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000679583 (Chr13:114584767..114584904 +)
Downstram Exon
ENSMUSE00000568635 (Chr13:114712455..114712599 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGGATAACTGAGGCGTTTCT Chr13:114584869..114584888 59.34 50 CCCGTGAGACCTATGCAAAC Chr13:114712534..114712553 60.52 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000679583 Chr13:114584767..114584904 CGGATAACTGAGGCGTTTCT Chr13:114584869..114584888 59.34 50

*** Putative Vector Insertion (Chr 13: 114584905 - 114712454) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000568635 Chr13:114712455..114712599 CCCGTGAGACCTATGCAAAC Chr13:114712534..114712553 60.52 55
downstream ENSMUSE00000307076 Chr13:114724272..114724331 CATTCAAAACGGCATTCTGG Chr13:114724319..114724338 61.39 45
downstream ENSMUSE00000307071 Chr13:114757790..114757998 CTTGGTAGTAGCGGCTCCAG Chr13:114757834..114757853 60.03 60
downstream ENSMUSE00000568639 Chr13:114944912..114947663 TGTAAAGCATCAGGCGTCAG Chr13:114947135..114947154 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAGACTCCAGTAGACCCCAGAG Chr13:114641856..114641878 59.36 59.09 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TATCCGTGACTGGGAAAACC Chr13:114614952..114614972 59.79 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000042348