Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI518
Trapped Gene
Arl15 (ENSMUSG00000042348)
Vector Insertion
Chr 13: 114584905 - 114712454
Public Clones (sanger) (sanger) CB0283 (sanger) CF0775 (sanger) AD0364 (sanger)
AR0334 (sanger) AM0263 (sanger) (sanger) (sanger) CJ0494 (sanger)
AC0487 (sanger) AT0578 (sanger) AX0496 (sanger) (sanger)
(sanger) CH0766 (sanger) AD0111 (sanger) AV0743 (sanger) AL0759 (sanger)
(sanger) (sanger) AZ0332 (sanger) AZ0174 (sanger) AD0363 (sanger)
AD0629 (sanger) (sanger) CJ0348 (sanger) CH0758 (sanger) AF0334 (sanger)
AW0416 (sanger) (sanger) (sanger) CH0611 (sanger) AD0110 (sanger)
AS1048 (sanger) AR0554 (sanger) (sanger) (sanger) CJ0518 (sanger)
AD0099 (sanger) CD0008 (sanger) AX0497 (sanger) (sanger)
CJ0030 (sanger) XR0035 (sanger) AR0908 (sanger) AN0298 (sanger)
XL531 (baygenomics) RRT324 (baygenomics) RRO121 (baygenomics) DTM013 (baygenomics)
RRF211 (baygenomics) RRK299 (baygenomics) NPX233 (baygenomics) RRO112 (baygenomics)
P096D06 (ggtc) 5SE307E06 (ggtc) 3SD185F01 (ggtc) (ggtc)
P007B06 (ggtc) 3SD078H11 (ggtc) 5SD105E05 (ggtc) (ggtc)
D023D01 (ggtc) W185D04 (ggtc) 3SE020G10 (ggtc) P023D07 (ggtc) Q022F08 (ggtc)
3SE307E06 (ggtc) 3SD150C11 (ggtc) (ggtc) D054C02 (ggtc) W244D06 (ggtc)
5SD054C02 (ggtc) 3SD105E05 (ggtc) (ggtc) D018B01 (ggtc) 5SD185F01 (ggtc)
P026G10 (ggtc) P015C04 (ggtc) 5SD078H11 (ggtc) 5SD119G07 (ggtc) (ggtc)
P065D03 (ggtc) W272B03 (ggtc) 5SE043A04 (ggtc) 5SD088E09 (ggtc) (ggtc)
P023D10 (ggtc) CMHD-GT_296A5-3 (cmhd) FHCRC-GT-S5-8A1 (fhcrc) (egtc)
Ayu21-T275 (egtc) (egtc) IST14138F7 (tigm) IST14501G3 (tigm) IST11388H10 (tigm)
IST14578A4 (tigm) IST14582G2 (tigm) IST13074H11 (tigm) IST14189D7 (tigm)
IST12860G3 (tigm) IST14193D1 (tigm) IST13638G11 (tigm) IST14375H2 (tigm)
IST14190H10 (tigm) IST14667G7 (tigm) IST14815A4 (tigm) IST14615H8 (tigm)
IST11579A7 (tigm) IST14531A9 (tigm) IST10465F6 (tigm) IST10831D1 (tigm)
IST13631G5 (tigm) IST15101F2 (tigm) IST14471F11 (tigm) IST14493F11 (tigm)
IST10786D10 (tigm) IST14625D1 (tigm) IST12182H11 (tigm) IST12109H11 (tigm)
IST14477D3 (tigm) IST11526E1 (tigm) IST14699G5 (tigm) IST14221A7 (tigm)
IST10838D1 (tigm) IST14377C6 (tigm) IST14299C1 (tigm) IST14974C4 (tigm)
IST14340G5 (tigm) IST14654G8 (tigm) IST15058C1 (tigm) IST14485H5 (tigm)
IST14492B6 (tigm) IST14699G5 (tigm) IST11112H5 (tigm) IST14871C11 (tigm)
IST15109C11 (tigm) IST14388E1 (tigm) IST10057A1 (tigm)
Private Clones OST263035 (lexicon) OST226091 (lexicon) OST138309 (lexicon) OST43080 (lexicon)
Severity of mutation (?) Insertion after 8% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000679583 (Chr13:114584767..114584904 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGGATAACTGAGGCGTTTCT Chr13:114584869..114584888 59.34 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000679583 (Chr13:114584767..114584904 +)
Downstram Exon
ENSMUSE00000568635 (Chr13:114712455..114712599 +)
Forward Primer Location Tm %GC