Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI5181
Trapped Gene
Msh2 (ENSMUSG00000024151)
Vector Insertion
Chr 17: 88088482 - 88095834
Public Clones (sanger) HMA065 (baygenomics) XE048 (baygenomics) YTC119 (baygenomics)
IST14729F9 (tigm)
Private Clones OST467685 (lexicon) OST459917 (lexicon) OST426321 (lexicon) OST424089 (lexicon)
Severity of mutation (?) Insertion after 45% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000138725 (Chr17:88088282..88088481 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGGAAGCTTTTGTCGAGGAT Chr17:88088293..88088312 59.81 45 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000138725 (Chr17:88088282..88088481 +)
Downstram Exon
ENSMUSE00000138767 (Chr17:88095835..88095944 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGGAAGCTTTTGTCGAGGAT Chr17:88088293..88088312 59.81 45 CAACAGTGCCTGGTGTCTTC Chr17:88095857..88095876 59.31 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000336236 Chr17:88071912..88072146 TAAGGAGACGCTGCAGTTGG Chr17:88071950..88071969 61.5 55
upstream ENSMUSE00000138776 Chr17:88077548..88077702 TCTTCTTCTGGTTCGCCAGT Chr17:88077609..88077628 59.99 50
upstream ENSMUSE00000138731 Chr17:88079140..88079418 CCAATCTCGAGGCTCTTCTG Chr17:88079327..88079346 60.09 55
upstream ENSMUSE00000138755 Chr17:88081871..88082017 CTGCCCTACCAGAGATGGAG Chr17:88081992..88082011 59.82 60
upstream ENSMUSE00000138745 Chr17:88084777..88084926 CGATTCAAATTTTGGGCAGT Chr17:88084830..88084849 59.94 40
upstream ENSMUSE00000138765 Chr17:88085636..88085769 CAGTCTCTGGCCGCATTATT Chr17:88085663..88085682 60.24 50
upstream ENSMUSE00000138725 Chr17:88088282..88088481 TGGAAGCTTTTGTCGAGGAT Chr17:88088293..88088312 59.81 45

*** Putative Vector Insertion (Chr 17: 88088482 - 88095834) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000138767 Chr17:88095835..88095944 CAACAGTGCCTGGTGTCTTC Chr17:88095857..88095876 59.31 55
downstream ENSMUSE00000138771 Chr17:88106522..88106645 CAGGCCATCCATGACTTCTC Chr17:88106602..88106621 60.62 55
downstream ENSMUSE00000138763 Chr17:88107792..88107942 TTCTTGTTGTTGCGAAGCAC Chr17:88107897..88107916 60.03 45
downstream ENSMUSE00000138751 Chr17:88111969..88112066 CATCCTGGGCCTCTTCATAC Chr17:88112036..88112055 59.51 55
downstream ENSMUSE00000138740 Chr17:88116795..88117040 CGAAGCTAACAATGGCGTCT Chr17:88116863..88116882 60.41 50
downstream ENSMUSE00000138749 Chr17:88117941..88118145 GACACTTCTGCCGACTCACA Chr17:88118046..88118065 60.03 55
downstream ENSMUSE00000138753 Chr17:88118628..88118875 AAAGGCACCAATCTTCGTTG Chr17:88118751..88118770 60.11 45
downstream ENSMUSE00000240026 Chr17:88120223..88120398 CACGTGAATCCCGAAACTCT Chr17:88120257..88120276 60.11 50
downstream ENSMUSE00000353715 Chr17:88122671..88123052 GCTTGACCTTCGACAGGAAC Chr17:88122716..88122735 59.85 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CATAATCGCCTTGCAGCACA Chr17:88094531..88094551 63.21 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTCCACGTGACTGGGAAAAC Chr17:88094528..88094548 60.93 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024151