Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI5198
Trapped Gene
Dync1li1 (ENSMUSG00000032435)
Vector Insertion
Chr 9: 114598401 - 114614171
Public Clones CSA050 (baygenomics) YTC004 (baygenomics) HMA245 (baygenomics) CSA017 (baygenomics)
CMHD-GT_505F7-3 (cmhd) IST14745D8 (tigm) IST11513D6 (tigm)
Private Clones OST181908 (lexicon)
Severity of mutation (?) Insertion after 14% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000329967 (Chr9:114598327..114598400 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATCCTCAGCGAGGTCTCCAC Chr9:114598334..114598353 61.76 60 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000329967 (Chr9:114598327..114598400 +)
Downstram Exon
ENSMUSE00000329943 (Chr9:114614172..114614288 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATCCTCAGCGAGGTCTCCAC Chr9:114598334..114598353 61.76 60 CTGTCTTCGTCGTGCACATT Chr9:114614286..114614305 59.9 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000353227 Chr9:114597908..114598145 CTCGTTCGGTTCATCTCCAC Chr9:114598023..114598042 60.66 55
upstream ENSMUSE00000329967 Chr9:114598327..114598400 ATCCTCAGCGAGGTCTCCAC Chr9:114598334..114598353 61.76 60

*** Putative Vector Insertion (Chr 9: 114598401 - 114614171) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000329943 Chr9:114614172..114614288 CTGTCTTCGTCGTGCACATT Chr9:114614286..114614305 59.9 50
downstream ENSMUSE00000329919 Chr9:114615125..114615355 GGGCATCCAGAGAGAACTTG Chr9:114615205..114615224 59.8 55
downstream ENSMUSE00000329887 Chr9:114618263..114618432 TCCTGGCTCCACGTACTCTT Chr9:114618300..114618319 59.87 55
downstream ENSMUSE00000329856 Chr9:114622628..114622721 CAGAACTTGCGGATGTGAGA Chr9:114622716..114622735 59.98 50
downstream ENSMUSE00000219724 Chr9:114624212..114624347 GAACCCGTACAGCTTCTGGA Chr9:114624303..114624322 60.26 55
downstream ENSMUSE00000219725 Chr9:114624718..114624829 TATCATTATCCCACCCTGCTG Chr9:114624742..114624762 59.79 47.62
downstream ENSMUSE00000219728 Chr9:114626981..114627040 CTGCCATGATCTCCTTCTCA Chr9:114627011..114627030 58.9 50
downstream ENSMUSE00000329634 Chr9:114628976..114629020 TTGGAGGTTGCTTTGCTAAAA Chr9:114629002..114629022 59.88 38.1
downstream ENSMUSE00000219723 Chr9:114629667..114629787 CTGGCAACATTGGATGACAC Chr9:114629740..114629759 59.97 50
downstream ENSMUSE00000219726 Chr9:114630823..114630975 GTTGAAGAAATTCGCCAGGA Chr9:114630866..114630885 60.19 45
downstream ENSMUSE00000505284 Chr9:114632371..114633420 GAAGCAGGTTTCCGTGTGAT Chr9:114632437..114632456 60.12 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr9:114601451..114601471 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGCAACTCAGTTAGGAGAGTCTTG Chr9:114601353..114601377 60.11 45.83 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032435