Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI5206
Trapped Gene
Mcl1 (ENSMUSG00000038612)
Vector Insertion
Chr 3: 95463411 - 95463683
Public Clones YTC016 (baygenomics) PST11497-NR (escells) PST10741-NR (escells) PST15177-NR (escells)
PST11472-NR (escells) PST2015-NR (escells) PST11624-NR (escells) PST10743-NR (escells)
PST11859-NR (escells) IST10405H4 (tigm)
Private Clones OST427418 (lexicon) OST359365 (lexicon) OST184497 (lexicon) OST135730 (lexicon)
OST112296 (lexicon)
Severity of mutation (?) Insertion after 64% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000383455 (Chr3:95462915..95463410 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GACGACCTATACCGCCAGTC Chr3:95463236..95463255 59.58 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000383455 (Chr3:95462915..95463410 +)
Downstram Exon
ENSMUSE00000251906 (Chr3:95463684..95463931 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GACGACCTATACCGCCAGTC Chr3:95463236..95463255 59.58 60 CCCAGTTTGTTACGCCATCT Chr3:95463782..95463801 59.99 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000398583 Chr3:95462779..95462913 TCATCGGCTTGAACCTGTACT Chr3:95462804..95462824 59.75 47.62
upstream ENSMUSE00000383455 Chr3:95462915..95463410 GACGACCTATACCGCCAGTC Chr3:95463236..95463255 59.58 60

*** Putative Vector Insertion (Chr 3: 95463411 - 95463683) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000251906 Chr3:95463684..95463931 CCCAGTTTGTTACGCCATCT Chr3:95463782..95463801 59.99 50
downstream ENSMUSE00000397122 Chr3:95464630..95467099 AAAGCCAGCAGCACATTTCT Chr3:95464700..95464719 60.02 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGAAGAGGGAAGAGCCGTAA Chr3:95463445..95463465 60.7 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGACGGCCTTCCAGGGTAA Chr3:95463396..95463416 63.67 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038612