Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI525
Trapped Gene
Nbn (ENSMUSG00000028224)
Vector Insertion
Chr 4: 15911170 - 15913655
Public Clones CA0090 (sanger) CA0144 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 85% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000251251 (Chr4:15911101..15911169 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGACAGAGTCGTGGTCAACA Chr4:15911134..15911154 59.92 52.38 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000251251 (Chr4:15911101..15911169 +)
Downstram Exon
ENSMUSE00000251244 (Chr4:15913656..15913811 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGACAGAGTCGTGGTCAACA Chr4:15911134..15911154 59.92 52.38 CTGGAGGTGGAGTTGTGGTT Chr4:15913759..15913778 60 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000346939 Chr4:15885115..15885257 No primer for this exon
upstream ENSMUSE00000251302 Chr4:15889458..15889591 GGAGTACGTTGTTGGGAGGA Chr4:15889486..15889505 59.97 55
upstream ENSMUSE00000177365 Chr4:15890919..15891067 TTCCTGCACGTTGAAGACAG Chr4:15891008..15891027 60.03 50
upstream ENSMUSE00000177364 Chr4:15891394..15891553 GGAGGACTTACCGCAAACAA Chr4:15891479..15891498 60.11 50
upstream ENSMUSE00000177367 Chr4:15892281..15892384 No primer for this exon
upstream ENSMUSE00000177362 Chr4:15896488..15896605 TACCCACCCATTGATGAACC Chr4:15896492..15896511 60.44 50
upstream ENSMUSE00000177363 Chr4:15897868..15898061 CCTGCGTTGTTGATGTAGGA Chr4:15897968..15897987 59.72 50
upstream ENSMUSE00000177370 Chr4:15898913..15899010 CTGAAGCGGAGATTGGATTG Chr4:15898933..15898952 60.73 50
upstream ENSMUSE00000177357 Chr4:15903182..15903311 ACAACGACTCCAGGACCAAG Chr4:15903190..15903209 60.15 55
upstream ENSMUSE00000177371 Chr4:15906288..15906560 CAGCAGCAGAACTCCATCAA Chr4:15906511..15906530 60.14 50
upstream ENSMUSE00000177360 Chr4:15908454..15908895 AGAGCTGTCCTCGTGCAAAT Chr4:15908475..15908494 60.02 50
upstream ENSMUSE00000251251 Chr4:15911101..15911169 CAGACAGAGTCGTGGTCAACA Chr4:15911134..15911154 59.92 52.38

*** Putative Vector Insertion (Chr 4: 15911170 - 15913655) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000251244 Chr4:15913656..15913811 CTGGAGGTGGAGTTGTGGTT Chr4:15913759..15913778 60 55
downstream ENSMUSE00000177361 Chr4:15916149..15916262 CGGTATTCTTTCGAGCATGG Chr4:15916233..15916252 60.6 50
downstream ENSMUSE00000177368 Chr4:15918329..15918378 GCAAGAGATTCCTCCTTTGCT Chr4:15918365..15918385 59.98 47.62
downstream ENSMUSE00000416563 Chr4:15919581..15919735 ACAGCTTCCTTTACAAGGTTCAA Chr4:15919631..15919653 59.36 39.13

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr4:15911220..15911240 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTACCACGTGACTGGGAAAA Chr4:15911215..15911235 58.62 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028224