Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI5257
Trapped Gene
Pank2 (ENSMUSG00000037514)
Vector Insertion
Chr 2: 131088552 - 131098916
Public Clones YTA478 (baygenomics) YHD123 (baygenomics) SYA153 (baygenomics) YTA317 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 21% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000404223 (Chr2:131088236..131088551 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGAGGCGGAGAGTGTGAGAC Chr2:131088454..131088473 62.38 65 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000404223 (Chr2:131088236..131088551 +)
Downstram Exon
ENSMUSE00000683071 (Chr2:131098917..131098940 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGAGGCGGAGAGTGTGAGAC Chr2:131088454..131088473 62.38 65 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000404223 Chr2:131088236..131088551 GGAGGCGGAGAGTGTGAGAC Chr2:131088454..131088473 62.38 65

*** Putative Vector Insertion (Chr 2: 131088552 - 131098916) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000683071 Chr2:131098917..131098940 No primer for this exon
downstream ENSMUSE00000254991 Chr2:131099647..131099999 CTTGACCAAGGTTCCTCCAA Chr2:131099693..131099712 60.08 50
downstream ENSMUSE00000640893 Chr2:131099647..131099715 CTTGACCAAGGTTCCTCCAA Chr2:131099693..131099712 60.08 50
downstream ENSMUSE00000640892 Chr2:131099721..131099999 GTGGATCCGTAAGCCACATT Chr2:131099803..131099822 59.82 50
downstream ENSMUSE00000254985 Chr2:131105893..131106146 CCAGTTTTCGAAGCTGAAGG Chr2:131105923..131105942 59.99 50
downstream ENSMUSE00000558513 Chr2:131108328..131108504 GGCAAGCCAAACCTCTCATA Chr2:131108486..131108505 60.21 50
downstream ENSMUSE00000254975 Chr2:131113210..131113333 AGCCAATGTTGTTGGTGATG Chr2:131113307..131113326 59.42 45
downstream ENSMUSE00000254969 Chr2:131119135..131119260 ATTGCCGACAAATACGACCT Chr2:131119167..131119186 59.46 45
downstream ENSMUSE00000254964 Chr2:131122009..131122427 GGTTAATAACGCTGCCCTGA Chr2:131122306..131122325 60.1 50
downstream ENSMUSE00000706239 Chr2:131122009..131122059 TCAACAGCTCGAGGAGTGCT Chr2:131122051..131122070 61.3 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGTGGCAGTCCTTGTGTGTG Chr2:131097515..131097535 59.78 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGTGGCAGTCCTTGTGTGTG Chr2:131097515..131097535 59.78 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037514