Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI5302
Trapped Gene
Snrpb (ENSMUSG00000027404)
Vector Insertion
Chr 2: 129997680 - 129998338
Public Clones YTA390 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 99% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000661565 (Chr2:129998339..129998464 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000661565 (Chr2:129998339..129998464 -)
Downstram Exon
ENSMUSE00000661564 (Chr2:129997386..129997679 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon ACCAGCTTCATAGGCCACAG Chr2:129997386..129997405 60.28 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000661566 Chr2:130004970..130005053 AGGCCTCTGTGGCAGAGAAT Chr2:130005006..130005025 61.33 55
upstream ENSMUSE00000558991 Chr2:130002751..130002902 ATCTTCATCGGGACCTTCAA Chr2:130002811..130002830 59.48 45
upstream ENSMUSE00000169180 Chr2:130001066..130001177 AAGGGAAGAGAAGCGAGTCC Chr2:130001134..130001153 59.96 55
upstream ENSMUSE00000558989 Chr2:129999343..129999495 No primer for this exon
upstream ENSMUSE00000558988 Chr2:129998772..129998910 CCCAACTCAGTACCCACCTG Chr2:129998820..129998839 60.41 60
upstream ENSMUSE00000661565 Chr2:129998339..129998464 No primer for this exon

*** Putative Vector Insertion (Chr 2: 129997680 - 129998338) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000661564 Chr2:129997386..129997679 ACCAGCTTCATAGGCCACAG Chr2:129997386..129997405 60.28 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000027404