Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI5309
Trapped Gene
Hspbap1 (ENSMUSG00000022849)
Vector Insertion
Chr 16: 35787462 - 35801622
Public Clones SYA280 (baygenomics) CSH354 (baygenomics) YHB170 (baygenomics) A046F08 (ggtc)
IST10062C2 (tigm) IST15060F8 (tigm)
Private Clones OST451399 (lexicon) OST350787 (lexicon)
Severity of mutation (?) Insertion after 17% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000516388 (Chr16:35787276..35787461 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACTGGACTGCGAAACACCTT Chr16:35787381..35787400 59.77 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000516388 (Chr16:35787276..35787461 +)
Downstram Exon
ENSMUSE00000131275 (Chr16:35801623..35801804 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACTGGACTGCGAAACACCTT Chr16:35787381..35787400 59.77 50 TCAGCGTAAGCCCAGAATTT Chr16:35801758..35801777 59.85 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000394995 Chr16:35770472..35770625 GAGGATCCTTCCTGTGTGGA Chr16:35770482..35770501 60.05 55
upstream ENSMUSE00000516388 Chr16:35787276..35787461 ACTGGACTGCGAAACACCTT Chr16:35787381..35787400 59.77 50

*** Putative Vector Insertion (Chr 16: 35787462 - 35801622) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000131275 Chr16:35801623..35801804 TCAGCGTAAGCCCAGAATTT Chr16:35801758..35801777 59.85 45
downstream ENSMUSE00000131273 Chr16:35814004..35814140 ACCCAAAGTCAGACCACACC Chr16:35814031..35814050 59.86 55
downstream ENSMUSE00000325705 Chr16:35817238..35817409 GAACTGGGGGAAACACTTCA Chr16:35817370..35817389 59.94 50
downstream ENSMUSE00000131261 Chr16:35818765..35818848 TGACGGTGACAGGATCAAGA Chr16:35818828..35818847 60.25 50
downstream ENSMUSE00000131271 Chr16:35824775..35824885 No primer for this exon
downstream ENSMUSE00000386605 Chr16:35824969..35828532 TTTGGCTACTGAGCGATGTG Chr16:35826611..35826630 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACCTGACCTGTTCCCTCTCC Chr16:35787469..35787489 60.5 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTGGTGAATGCCAACACTGA Chr16:35787446..35787466 60.58 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022849