Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI531
Trapped Gene
Mcl1 (ENSMUSG00000038612)
Vector Insertion
Chr 3: 95463932 - 95464629
Public Clones (sanger) CA0050 (sanger) XL078 (baygenomics) RRU178 (baygenomics) RRF509 (baygenomics)
P143D02 (ggtc) (ggtc) P143D02 (ggtc) (ggtc) M123C03 (ggtc) P143D02 (ggtc)
(ggtc) IST10986B1 (tigm) IST12788B8 (tigm) IST14319D5 (tigm) IST14122B9 (tigm)
Private Clones OST426996 (lexicon) OST424966 (lexicon) OST402314 (lexicon) OST361192 (lexicon)
OST345143 (lexicon) OST341906 (lexicon) OST333172 (lexicon) OST231628 (lexicon)
OST193484 (lexicon) OST171563 (lexicon) OST62533 (lexicon) OST42049 (lexicon)
Severity of mutation (?) Insertion after 89% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000251906 (Chr3:95463684..95463931 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTAAGGACGAAACGGGACTG Chr3:95463890..95463909 59.59 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000251906 (Chr3:95463684..95463931 +)
Downstram Exon
ENSMUSE00000397122 (Chr3:95464630..95467099 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTAAGGACGAAACGGGACTG Chr3:95463890..95463909 59.59 55 AAAGCCAGCAGCACATTTCT Chr3:95464700..95464719 60.02 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000398583 Chr3:95462779..95462913 TCATCGGCTTGAACCTGTACT Chr3:95462804..95462824 59.75 47.62
upstream ENSMUSE00000383455 Chr3:95462915..95463410 GACGACCTATACCGCCAGTC Chr3:95463236..95463255 59.58 60
upstream ENSMUSE00000251906 Chr3:95463684..95463931 GTAAGGACGAAACGGGACTG Chr3:95463890..95463909 59.59 55

*** Putative Vector Insertion (Chr 3: 95463932 - 95464629) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000397122 Chr3:95464630..95467099 AAAGCCAGCAGCACATTTCT Chr3:95464700..95464719 60.02 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGCTGGGTAAGTTCGTCTTG Chr3:95463927..95463947 59.73 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGCTGGGTAAGTTCGTCTTG Chr3:95463927..95463947 59.73 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038612