Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI5314
Trapped Gene
Nr6a1 (ENSMUSG00000063972)
Vector Insertion
Chr 2: 38728160 - 38740715
Public Clones SYA301 (baygenomics) RRA042 (baygenomics) 5SE306B10 (ggtc) IST14885B10 (tigm)
IST14753E6 (tigm) IST13062E6 (tigm)
Private Clones OST438256 (lexicon) OST432371 (lexicon) OST413186 (lexicon) OST401576 (lexicon)
OST357655 (lexicon) OST345339 (lexicon) OST341572 (lexicon)
Severity of mutation (?) Insertion after 22% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000361887 (Chr2:38740716..38740757 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAATTGGCAGAGCTTGATCC Chr2:38740724..38740743 59.78 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000361887 (Chr2:38740716..38740757 -)
Downstram Exon
ENSMUSE00000439314 (Chr2:38728115..38728159 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAATTGGCAGAGCTTGATCC Chr2:38740724..38740743 59.78 50 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000693506 Chr2:38783106..38783208 TTCGATACGGCCCATTAGAG Chr2:38783143..38783162 60.05 50
upstream ENSMUSE00000645525 Chr2:38781638..38781737 No primer for this exon
upstream ENSMUSE00000693496 Chr2:38781638..38781940 ACTACGAAGGCGCAAGTCAT Chr2:38781779..38781798 59.9 50
upstream ENSMUSE00000693505 Chr2:38781638..38782023 ACTACGAAGGCGCAAGTCAT Chr2:38781779..38781798 59.9 50
upstream ENSMUSE00000361887 Chr2:38740716..38740757 GAATTGGCAGAGCTTGATCC Chr2:38740724..38740743 59.78 50

*** Putative Vector Insertion (Chr 2: 38728160 - 38740715) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000439314 Chr2:38728115..38728159 No primer for this exon
downstream ENSMUSE00000693504 Chr2:38617789..38617798 No primer for this exon
downstream ENSMUSE00000162399 Chr2:38615707..38615949 TGTTGCAAATGCTCCTCTTG Chr2:38615799..38615818 59.99 45
downstream ENSMUSE00000693503 Chr2:38615707..38615955 GGTTCGTTGTTCAGCTCGAT Chr2:38615893..38615912 60.26 50
downstream ENSMUSE00000162393 Chr2:38604356..38604411 TGGACTGGTCCAATGCTCTT Chr2:38604335..38604354 60.66 50
downstream ENSMUSE00000162401 Chr2:38598327..38598481 CATGGTTGCTCCAGTGATTG Chr2:38598384..38598403 60.11 50
downstream ENSMUSE00000714423 Chr2:38595900..38596127 ATCCCTGAATGCCATGAATC Chr2:38596066..38596085 59.72 45
downstream ENSMUSE00000717033 Chr2:38595900..38596127 ATCCCTGAATGCCATGAATC Chr2:38596066..38596085 59.72 45
downstream ENSMUSE00000693493 Chr2:38594407..38594661 GCTTCTTGATCCAGGCAATC Chr2:38594551..38594570 59.78 50
downstream ENSMUSE00000711441 Chr2:38594407..38594661 GCTTCTTGATCCAGGCAATC Chr2:38594551..38594570 59.78 50
downstream ENSMUSE00000711939 Chr2:38594407..38594661 GCTTCTTGATCCAGGCAATC Chr2:38594551..38594570 59.78 50
downstream ENSMUSE00000162402 Chr2:38586566..38586687 TTCATGCATGCGTACTCCTC Chr2:38586567..38586586 59.83 50
downstream ENSMUSE00000693500 Chr2:38586566..38586687 TTCATGCATGCGTACTCCTC Chr2:38586567..38586586 59.83 50
downstream ENSMUSE00000162396 Chr2:38585003..38585155 GTATCGGATCTCTGGCAAGC Chr2:38584988..38585007 59.8 55
downstream ENSMUSE00000693499 Chr2:38585003..38585155 GTATCGGATCTCTGGCAAGC Chr2:38584988..38585007 59.8 55
downstream ENSMUSE00000693497 Chr2:38582434..38583435 GGCTTGTGGGATGAGATGAT Chr2:38582737..38582756 59.89 50
downstream ENSMUSE00000603271 Chr2:38578890..38583435 ACATTAAAGGCGGTCCACAG Chr2:38581077..38581096 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATGATGGGTCCGTAATCG Chr2:38731658..38731678 58.31 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AATGGCGCATTTGTTCAGTA Chr2:38731670..38731690 59.19 40 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CTGGTGGGCTCTGTGACTTC Chr2:38731725..38731745 60.86 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CTGGTGGGCTCTGTGACTTC Chr2:38731725..38731745 60.86 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000063972