Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI532
Trapped Gene
2410001C21Rik (ENSMUSG00000027502)
Vector Insertion
Chr 2: 172272614 - 172278751
Public Clones CF0553 (sanger) CA0045 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000170133 (Chr2:172272535..172272613 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCTGCGGTTGTGTGTTTTCT Chr2:172272552..172272571 61.28 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000170133 (Chr2:172272535..172272613 +)
Downstram Exon
ENSMUSE00000679121 (Chr2:172278752..172278817 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCTGCGGTTGTGTGTTTTCT Chr2:172272552..172272571 61.28 50 TGAGGGCACATCACACACAT Chr2:172278774..172278793 61.05 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000170124 Chr2:172266090..172266239 GGTTTCTGATTTCGGCTTTG Chr2:172266149..172266168 59.69 45
upstream ENSMUSE00000170125 Chr2:172270147..172270241 TGACAAAGACGCTGAACTGG Chr2:172270149..172270168 60.03 50
upstream ENSMUSE00000170130 Chr2:172270827..172270920 GCGGTCATCGAGTTTCTGTT Chr2:172270843..172270862 60.26 50
upstream ENSMUSE00000170128 Chr2:172272122..172272261 GACAAGCATGATGACCTCCA Chr2:172272188..172272207 59.64 50
upstream ENSMUSE00000170133 Chr2:172272535..172272613 GCTGCGGTTGTGTGTTTTCT Chr2:172272552..172272571 61.28 50

*** Putative Vector Insertion (Chr 2: 172272614 - 172278751) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000679121 Chr2:172278752..172278817 TGAGGGCACATCACACACAT Chr2:172278774..172278793 61.05 50
downstream ENSMUSE00000170132 Chr2:172288677..172288790 CAGCATCTCCACATCCTCCT Chr2:172288748..172288767 60.22 55
downstream ENSMUSE00000170126 Chr2:172291774..172291831 GTCGCTGTCTTCGGTTTCTT Chr2:172291802..172291821 59.48 50
downstream ENSMUSE00000170134 Chr2:172291929..172292024 CAGGCTTGCCAGACTTCACT Chr2:172291970..172291989 60.59 55
downstream ENSMUSE00000170123 Chr2:172294096..172294367 CCAGACGCACTCCCATTAGT Chr2:172294120..172294139 60.13 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr2:172275665..172275685 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGTTTCTTCTCTGGGTTCACTTA Chr2:172275566..172275589 58.81 43.48 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027502