Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI5320
Trapped Gene
Smg5 (ENSMUSG00000001415)
Vector Insertion
Chr 3: 88140420 - 88145779
Public Clones (sanger) (sanger) XH037 (baygenomics) SYA313 (baygenomics) M065D08 (ggtc)
5SD010E11 (ggtc) E123A09 (ggtc) W058B05 (ggtc) 3SD010E11 (ggtc) E076D03 (ggtc)
W193C04 (ggtc) M125E01 (ggtc) E076D03 (ggtc) (cmhd) IST14305A4 (tigm)
IST14426F6 (tigm)
Private Clones OST217843 (lexicon) OST207630 (lexicon) OST197539 (lexicon) OST186595 (lexicon)
OST184017 (lexicon)
Severity of mutation (?) Insertion after 2% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000382490 (Chr3:88140182..88140419 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000382490 (Chr3:88140182..88140419 +)
Downstram Exon
ENSMUSE00000337443 (Chr3:88145780..88145878 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000382490 Chr3:88140182..88140419 No primer for this exon

*** Putative Vector Insertion (Chr 3: 88140420 - 88145779) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000337443 Chr3:88145780..88145878 No primer for this exon
downstream ENSMUSE00000292662 Chr3:88146363..88146486 No primer for this exon
downstream ENSMUSE00000292657 Chr3:88146802..88146958 No primer for this exon
downstream ENSMUSE00000292652 Chr3:88149285..88149374 No primer for this exon
downstream ENSMUSE00000292644 Chr3:88150367..88150456 No primer for this exon
downstream ENSMUSE00000292636 Chr3:88151440..88151518 No primer for this exon
downstream ENSMUSE00000292628 Chr3:88153064..88153189 No primer for this exon
downstream ENSMUSE00000383784 Chr3:88153298..88153366 No primer for this exon
downstream ENSMUSE00000332247 Chr3:88153938..88154146 No primer for this exon
downstream ENSMUSE00000414804 Chr3:88154619..88154756 No primer for this exon
downstream ENSMUSE00000468549 Chr3:88154901..88155503 No primer for this exon
downstream ENSMUSE00000415631 Chr3:88156885..88157060 No primer for this exon
downstream ENSMUSE00000415614 Chr3:88157798..88157873 No primer for this exon
downstream ENSMUSE00000349815 Chr3:88158454..88158629 No primer for this exon
downstream ENSMUSE00000386983 Chr3:88159500..88159658 No primer for this exon
downstream ENSMUSE00000514555 Chr3:88162575..88162634 No primer for this exon
downstream ENSMUSE00000175663 Chr3:88162949..88163108 No primer for this exon
downstream ENSMUSE00000175659 Chr3:88163470..88163560 No primer for this exon
downstream ENSMUSE00000175662 Chr3:88164253..88164327 No primer for this exon
downstream ENSMUSE00000175657 Chr3:88164676..88164814 No primer for this exon
downstream ENSMUSE00000388799 Chr3:88164947..88166259 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCAAAGGTCCTCCACACCAA Chr3:88140389..88140409 63.37 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCAAAGGTCCTCCACACCAA Chr3:88140389..88140409 63.37 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000001415