Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI5331
Trapped Gene
Mkl2 (ENSMUSG00000079844)
Vector Insertion
Chr 16: 13326665 - 13332106
Public Clones SYA383 (baygenomics) CSH258 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 50% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000719134 (Chr16:13326475..13326664 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGGATCACACAGGAGCCATA Chr16:13326512..13326531 60.07 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000719134 (Chr16:13326475..13326664 +)
Downstram Exon
ENSMUSE00000365237 (Chr16:13332107..13332169 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGGATCACACAGGAGCCATA Chr16:13326512..13326531 60.07 50 AGTCCTGACTCCCCAAAGACT Chr16:13332136..13332156 59.21 52.38

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000704246 Chr16:13256599..13256647 No primer for this exon
upstream ENSMUSE00000704247 Chr16:13265169..13265232 No primer for this exon
upstream ENSMUSE00000704249 Chr16:13265172..13265232 No primer for this exon
upstream ENSMUSE00000395817 Chr16:13326475..13326664 TGGATCACACAGGAGCCATA Chr16:13326512..13326531 60.07 50
upstream ENSMUSE00000719134 Chr16:13326475..13326664 TGGATCACACAGGAGCCATA Chr16:13326512..13326531 60.07 50

*** Putative Vector Insertion (Chr 16: 13326665 - 13332106) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000365237 Chr16:13332107..13332169 AGTCCTGACTCCCCAAAGACT Chr16:13332136..13332156 59.21 52.38
downstream ENSMUSE00000408575 Chr16:13332712..13333012 AGGAGGCGTCTATTCCAGGT Chr16:13332870..13332889 60.1 55
downstream ENSMUSE00000704245 Chr16:13332712..13333015 AGGAGGCGTCTATTCCAGGT Chr16:13332870..13332889 60.1 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCGATGAGAAAAGCTCAGGT Chr16:13326692..13326712 59.58 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000079844