Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI5357
Trapped Gene
Yap1 (ENSMUSG00000053110)
Vector Insertion
Chr 9: 7953135 - 7962288
Public Clones (sanger) SYA411 (baygenomics) E118D10 (ggtc) (ggtc) IST11712D11 (tigm)
IST14894E7 (tigm)
Private Clones OST332639 (lexicon)
Severity of mutation (?) Insertion after 52% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000456652 (Chr9:7962289..7962402 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGCCATGACTCAGGATGGAG Chr9:7962358..7962377 60.22 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000456652 (Chr9:7962289..7962402 -)
Downstram Exon
ENSMUSE00000456648 (Chr9:7952953..7953134 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGCCATGACTCAGGATGGAG Chr9:7962358..7962377 60.22 55 TTTCAACCGCAGTCTCTCCT Chr9:7952952..7952971 59.99 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000456684 Chr9:8004115..8004594 CGTCTGGAGCCAAAGTTTCT Chr9:8004570..8004589 59.47 50
upstream ENSMUSE00000539850 Chr9:8004115..8004588 GCAAAGAAAGGGAGGAAGGA Chr9:8004520..8004539 60.68 50
upstream ENSMUSE00000456667 Chr9:8001457..8001707 CAGCATGTTCGAGCTCACTC Chr9:8001649..8001668 59.73 55
upstream ENSMUSE00000517511 Chr9:7973796..7973911 CCAGACGCTGATGAATTCTG Chr9:7973802..7973821 59.39 50
upstream ENSMUSE00000456652 Chr9:7962289..7962402 AGCCATGACTCAGGATGGAG Chr9:7962358..7962377 60.22 55

*** Putative Vector Insertion (Chr 9: 7953135 - 7962288) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000456648 Chr9:7952953..7953134 TTTCAACCGCAGTCTCTCCT Chr9:7952952..7952971 59.99 50
downstream ENSMUSE00000539852 Chr9:7950492..7950539 CATTTTGGAGCATTTGCTGT Chr9:7950474..7950493 58.77 40
downstream ENSMUSE00000456644 Chr9:7938408..7938538 TGCTCCAGTGTAGGCAACTG Chr9:7938479..7938498 60.05 55
downstream ENSMUSE00000456638 Chr9:7936515..7936627 GAGGGATGCTGTAGCTGCTC Chr9:7936538..7936557 60.13 60
downstream ENSMUSE00000456673 Chr9:7931999..7934732 AGAGAAAAGCGGAACAACGA Chr9:7934332..7934351 59.99 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTCAATCTCCCAGCCCTTCT Chr9:7959248..7959268 60.6 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTCCATTTGCCTTAGGCTTC Chr9:7959255..7959275 59.3 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 AGCCATGACTCAGGATGGAG Chr9:7959356..7959376 60.22 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 AGCCATGACTCAGGATGGAG Chr9:7959356..7959376 60.22 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000053110