Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI536
Trapped Gene
Trim71 (ENSMUSG00000079259)
Vector Insertion
Chr 9: 114434240 - 114471422
Public Clones (sanger) AZ0432 (sanger) (sanger) (sanger) XR1152 (sanger) (sanger)
(sanger) AK0501 (sanger) (sanger) (sanger) (sanger) CA0010 (sanger)
(sanger) (sanger) XP0019 (sanger) (sanger) RRR716 (baygenomics) RRF011 (baygenomics)
XM221 (baygenomics) RRT020 (baygenomics) RRF013 (baygenomics) RRJ340 (baygenomics)
XA144 (baygenomics) RRI268 (baygenomics) RRK374 (baygenomics) H006F07 (ggtc)
5SP141D05 (ggtc) 5SP134D06 (ggtc) 5SP105B06 (ggtc) (ggtc)
Q011A02 (ggtc) 3SP137F04 (ggtc) 3SP117D04 (ggtc) 5SH008C08 (ggtc)
(ggtc) 5SE285B02 (ggtc) 3SE066G11 (ggtc) 5SP107B06 (ggtc) 5SD130D06 (ggtc)
(ggtc) P134D06 (ggtc) 3SP141D05 (ggtc) 3SP134D06 (ggtc) 3SH009C10 (ggtc)
(ggtc) 5SE305F04 (ggtc) 3SE130D06 (ggtc) 5SP116B12 (ggtc) 5SH006F07 (ggtc)
(ggtc) 3SE284A07 (ggtc) 3SP137B05 (ggtc) 3SP107B06 (ggtc) (ggtc)
P116B12 (ggtc) 5SP137F04 (ggtc) 5SP117D04 (ggtc) 3SH008E07 (ggtc)
(ggtc) 5SE167C07 (ggtc) 5SE069C10 (ggtc) 3SP116B12 (ggtc) 3SH003G09 (ggtc)
(ggtc) (cmhd) (cmhd) (cmhd) IST14102F5 (tigm) IST13328E8 (tigm)
IST14447G8 (tigm) IST14486B6 (tigm) IST10088E4 (tigm) IST14682D4 (tigm)
IST14345E7 (tigm) IST10815B10 (tigm)
Private Clones OST468012 (lexicon) OST449469 (lexicon) OST379752 (lexicon) OST367027 (lexicon)
OST348852 (lexicon) OST316772 (lexicon) OST59118 (lexicon) OST38194 (lexicon)
Severity of mutation (?) Insertion after 32% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000689096 (Chr9:114471423..114473487 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGGGAGTCGTGCAAAATAAA Chr9:114473347..114473366 59.94 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000689096 (Chr9:114471423..114473487 -)
Downstram Exon
ENSMUSE00000689095 (Chr9:114434072..114434239 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGGGAGTCGTGCAAAATAAA Chr9:114473347..114473366 59.94 45 ACTCTCTGCAGATGGGGACA Chr9:114434169..114434188 60.83 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000689096 Chr9:114471423..114473487 GGGGAGTCGTGCAAAATAAA Chr9:114473347..114473366 59.94 45

*** Putative Vector Insertion (Chr 9: 114434240 - 114471422) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000689095 Chr9:114434072..114434239 ACTCTCTGCAGATGGGGACA Chr9:114434169..114434188 60.83 55
downstream ENSMUSE00000689094 Chr9:114424851..114424985 TCCACAACAGCTCACACTCC Chr9:114424831..114424850 59.87 55
downstream ENSMUSE00000689092 Chr9:114420393..114423214 ATTCTGCTGGTCGCTCACTT Chr9:114422713..114422732 60.02 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGTAATCGCCTTGCAGCAC Chr9:114459354..114459374 60.42 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACCACGACGATGAGGTGAGTG Chr9:114447414..114447435 63.54 57.14 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 ACATAATCGCCTTGCAGCAC Chr9:114461420..114461440 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CCTGGGTAGGGCCTAGTGAA Chr9:114461507..114461527 61.38 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000079259