Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI5398
Trapped Gene
Foxk1 (ENSMUSG00000056493)
Vector Insertion
Chr 5: 142931532 - 142932429
Public Clones CSJ073 (baygenomics) PST7037-NR (escells) PST746 (escells)
Private Clones not available
Severity of mutation (?) Insertion after 87% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000590040 (Chr5:142931307..142931531 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACGCTGTACCCACGAATAGC Chr5:142931493..142931512 60.16 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000590040 (Chr5:142931307..142931531 +)
Downstram Exon
ENSMUSE00000590039 (Chr5:142932430..142937968 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACGCTGTACCCACGAATAGC Chr5:142931493..142931512 60.16 55 AGCAGGCCCTTCTAGTCCTC Chr5:142936831..142936850 59.98 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000590046 Chr5:142877451..142877995 GGAGTTCGAGTTCCTGATGC Chr5:142877771..142877790 59.81 55
upstream ENSMUSE00000474194 Chr5:142911095..142911280 TCCCCACTGAAGATCCACAT Chr5:142911201..142911220 60.33 50
upstream ENSMUSE00000590045 Chr5:142924641..142924797 CAGAATGTGACCTCCGACCT Chr5:142924702..142924721 60.11 55
upstream ENSMUSE00000534632 Chr5:142926195..142926341 AAGCCACCGTACTCCTATGC Chr5:142926204..142926223 59.22 55
upstream ENSMUSE00000473425 Chr5:142927393..142927586 AAAGCGGAGACAGAGAGGTG Chr5:142927527..142927546 59.6 55
upstream ENSMUSE00000472392 Chr5:142929463..142929629 CATTCCACATGATCCCGACT Chr5:142929556..142929575 60.75 50
upstream ENSMUSE00000509938 Chr5:142929714..142929998 ACTCAGCCAACGGGTACATC Chr5:142929900..142929919 60 55
upstream ENSMUSE00000590040 Chr5:142931307..142931531 ACGCTGTACCCACGAATAGC Chr5:142931493..142931512 60.16 55

*** Putative Vector Insertion (Chr 5: 142931532 - 142932429) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000590039 Chr5:142932430..142937968 AGCAGGCCCTTCTAGTCCTC Chr5:142936831..142936850 59.98 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTGACTGGCAATGCTTATGG Chr5:142931514..142931534 59.69 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTGACTGGCAATGCTTATGG Chr5:142931514..142931534 59.69 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000056493